Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096772 Similarity: 0.992 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA096772
Gene: SERTAD2
MFE: -9.669
ENS: 0.932
Length: 64.
Predicted Ligands:
fluoride - 20/20 - 20/20


 RS: URS0000C6263F_1056511
MFE: -10.414
Ligand: fluoride
Species: Photobacterium marinum Fluoride riboswitch
 RS: URS0000D93F65_1798301
MFE: -12.829
Ligand: fluoride
Species: Gammaproteobacteria bacterium RIFCSPLOWO2_12_47_11 Fluoride riboswitch
 RS: URS0000DA5051_632518
MFE: -16.695
Ligand: fluoride
Species: Caldicellulosiruptor owensensis OL Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096772 URS0000C6263F_1056511 URS0000D93F65_1798301 URS0000DA5051_632518
Length 64. 64. 63. 64.
Similarity - 0.992 0.990 0.989
Ensemble Norm 0.932 - - -
MFE -9.669 -10.414 -12.829 -16.695
Ligands - fluoride fluoride fluoride
Gene SERTAD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2. 5.001
Length SE - 0. 1. 0.
Lev Distance - 10. 12. 13.
UBS 5. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 1. 1. 2. 1.
H 2. 2. 2. 2.
BL 2. 2. 2. 2.
BR 2. 1. 1. 0.
UN 0.172 0.172 0.159 0.141

Sequences

Field Description
UTR seq + 25 ggagcuggacugggugccgacuucuucgcagaaggauauATGTTGGGTAAAGGAGGAAAACGGA
UTR dot + 25 ((.(((……))).))..(((((((.(((………..))).)..))))))………
RS 1 seq UUCAUGACGGGUGAUGGAGUUCCACCUUUAACCGCUCUACUGAGAUGAUGACUCCUGCUGUAGU
RS 1 dot .((((…..)))).((((((.((.(((………….))).))..))))))………
RS 2 seq UUUCUGAAAGGAAAUGGCAUUCUUCCUUGAACCGUCCCAUGGACUGAUGAUGCCUGCGAGUUU
RS 2 dot (((((….))))).(((((((.(((.((……..)).)))..))..)))))………
RS 3 seq AUUGUAAAAGGCGAUGGAGUCCGCCGUACAAAUGCCAAUGAUGGCUGAUGACUCCUACAGAUGC
RS 3 dot (((((…..)))))((((((.(((((.((……..)))))))….))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table