Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096814 Similarity: 0.961 Similarity: 0.958 Similarity: 0.957
UTR: 5HSAA096814
Gene: SETD3
MFE: -43.699
ENS: 0.708
Length: 148.
Predicted Ligands:
cobalamin - 10/20
TPP - 4/20
molybdenum - 2/20
 RS: URS0000C2EA81_1813677
MFE: -67.994
Ligand: cobalamin
Species: Rhodococcus sp. EPR-157 AdoCbl riboswitch
 RS: URS0002332584_565034
MFE: -21.486
Ligand: cobalamin
Species: Brachyspira hyodysenteriae WA1 Cobalamin riboswitch
 RS: URS0002325484_1114943
MFE: -62.143
Ligand: cobalamin
Species: Streptomyces tsukubensis NRRL18488 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096814 URS0000C2EA81_1813677 URS0002332584_565034 URS0002325484_1114943
Length 148. 148. 147. 148.
Similarity - 0.961 0.958 0.957
Ensemble Norm 0.708 - - -
MFE -43.699 -67.994 -21.486 -62.143
Ligands - cobalamin cobalamin cobalamin
Gene SETD3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.026 14. 35.007
Length SE - 0. 1. 0.
Lev Distance - 52. 50. 46.
UBS 6. 6. 7. 9.
BS 3. 3. 0. 0.
ILL 4. 3. 3. 2.
ILR 3. 3. 2. 1.
H 2. 3. 2. 3.
BL 1. 1. 0. 3.
BR 1. 0. 2. 3.
UN 0.318 0.155 0.327 0.236

Sequences

Field Description
UTR seq + 25 cgccaccaagcgaccggaggggcggagagaguaggaugccugucaaccaaugggaagaaagcagagcucucaaaagaggaacgagccgccgcucuccuccccgcccgccccgcggucagaaaaATGGGTAAGAAGAGTCGAGTAAAAA
UTR dot + 25 ..(((……(((((..(((((((.((((((….(((…((..((….))..))..)))..))))))….(((((..((((….)))))))))…..))))))).)))))…….)))…………………
RS 1 seq AGAAGAACGACACCGGAGCUGGUGCGGGGAAGUCCUGUGCGAAUCAGGCGCGGUCCCGCCACUGUGUAGGUGCCGGGCACACUGCCCGGCACCGAAGUCAGAUCACCGCACAGCUUCGUAGUACGGCCCGUCUGUCCGGCGGGUCAUU
RS 1 dot ………((..(((((((.((((((((..(..((((((…….))))))..)..)).(((….(((((((((((…)))))))))))…..)))….)))))))))))))..))..((((((((…..))))))))…
RS 2 seq UAAAAAAAAUAUUAUAUAUAAUUUGCUGUCAAAGAAUAUGGGAAUGAGGGUGAAAAUCCUUCGCUGGCACGCAACCGUAAAGUUUAGUUUUUUAUAUAAAUAAAAUAACUAACGAAGUCGGAUACCAUUAAAAUAGGGAGUGCACUG
RS 2 dot ………………….(((((((((..((………..(((((….)))))))..))))).))))(((……((((((((((((….)))))).))))))……)))……………………..
RS 3 seq UCCAACUCCAUACGGGGCGGUGGGACCCAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGAACAGCCGCUGACACGUGCACGCACCCCGCGUGCCGUCCCGCGGCCGUCAGUCAGGAACUGACCCAUCGCCCUUCUCCCAU
RS 3 dot …………((.((.((((((((((…..(((((…….)))))).))))))))).)).))….(((((….(((.((((((…..)))))))))…))))).((((((…..))))))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table