Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA096868 Similarity: 0.967 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA096868
Gene: SETDB1
MFE: -45.188
ENS: 0.823
Length: 142.
Predicted Ligands:
cobalamin - 11/20
SAM - 3/20
TPP - 3/20
 RS: URS0002320EF4_1519495
MFE: -63.943
Ligand: cobalamin
Species: Streptomyces sp. NRRL F-6491 Cobalamin riboswitch
 RS: URS000231A060_114686
MFE: -60.925
Ligand: cobalamin
Species: Streptomyces phaeoluteigriseus Cobalamin riboswitch
 RS: URS0000AB4D70_12908
MFE: -22.853
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA096868 URS0002320EF4_1519495 URS000231A060_114686 URS0000AB4D70_12908
Length 142. 142. 142. 143.
Similarity - 0.967 0.963 0.963
Ensemble Norm 0.823 - - -
MFE -45.188 -63.943 -60.925 -22.853
Ligands - cobalamin cobalamin cobalamin
Gene SETDB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 10.002 3.002
Length SE - 0. 0. 1.
Lev Distance - 42. 45. 47.
UBS 10. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 5. 5. 3. 5.
ILR 3. 2. 3. 3.
H 3. 3. 5. 3.
BL 2. 3. 1. 3.
BR 3. 5. 3. 4.
UN 0.113 0.063 0.070 0.070

Sequences

Field Description
UTR seq + 25 aacgcaugcguaguuaccuuaguuuucgucgccucugaggggcgccccgcggcuuuggauuugaccccgucaggcuaccgucgcggugaccggaacggcacuaaagaggacaaaagcATGTCTTCCCTTCCTGGGTGCATTG
UTR dot + 25 .(((….)))……….(((((.((((((..(((.((..(((..((((….((……))))))..)))..)).))).)))))).))))).(((((…(((((((……)))))))……..)))))….
RS 1 seq CCCGUUCUCGGGGCGUGGUGGACUGCCGAGGCCAUUACGGCGGCAGCAGAGGAAGUCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUGACCGGAUCCGAGGGGUCCGGGAGCCAGGAACUCUCGCCGCCGGUCACGUCGAU
RS 1 dot ((((….))))..(((((((…((((..(((…..((..(((.(.((…..)).).)))….))))).)))).))))))).((((((((…((((((.(((……..))).))))))…))))))))……
RS 2 seq GCCGUUCCGGGCACGUGGUGGACUGCCGGAGCCAUGUACGGCGACAGAAGAGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGACACCCCCGGGAGCCAGGAACUCUCGUCGCCGGUCUCGUCGAA
RS 2 dot (((……)))..((((((((((((((((..((((..((((..(…….)..)))).))))..))))))..))))).)))))…….(((((….)))))((((((…….))))))(((.((….)).))).
RS 3 seq GUACUGAAUAAGUGAGUGGGGAAUAAUGUGUGAAUCAUUAACUGUUCCUGCAACGGUAAAACCUAAAAGUUAAGUCCGAGCGCCACCCAGUAUAGCCCGCUGUUGAAUGAAGGCCAGGAAAAGUCUAGUUCUGCAAUUAAAAA
RS 3 dot .((((…..))))((((((..(((.((.(((……………..((..(((…(((……)))….)))…))))).)).)))..))))))((.((((..((((……..)))).)))).))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table