Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA097583 Similarity: 0.959 Similarity: 0.958 Similarity: 0.957
UTR: 5HSAA097583
Gene: SGCE
MFE: -35.212
ENS: 0.892
Length: 136.
Predicted Ligands:
cobalamin - 15/20
FMN - 2/20
SAM - 1/20
 RS: URS0000D68A6A_12908
MFE: -22.186
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS000232F362_1801754
MFE: -29.242
Ligand: cobalamin
Species: Candidatus Nomurabacteria bacterium RIFCSPHIGHO2_02_FULL_41_18 Cobalamin riboswitch
 RS: URS000231C117_1618810
MFE: -36.093
Ligand: cobalamin
Species: Parcubacteria group bacterium GW2011_GWA2_37_10 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA097583 URS0000D68A6A_12908 URS000232F362_1801754 URS000231C117_1618810
Length 136. 134. 136. 135.
Similarity - 0.959 0.958 0.957
Ensemble Norm 0.892 - - -
MFE -35.212 -22.186 -29.242 -36.093
Ligands - cobalamin cobalamin cobalamin
Gene SGCE - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 1.078 3.014
Length SE - 4. 0. 1.
Lev Distance - 46. 57. 55.
UBS 9. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 1. 3. 2.
ILR 3. 2. 3. 3.
H 3. 2. 3. 4.
BL 2. 4. 2. 1.
BR 2. 2. 3. 2.
UN 0.029 0.030 0.309 0.148

Sequences

Field Description
UTR seq + 25 cgggauuaccgagggggugcgggaugcugaugcugaacuggccaagcugggagggaagaagaaagggaggggaggggagaaucgaggacggacggccuagccaggccaagaATGCAATTGCCCCGGTGGTGGGAGC
UTR dot + 25 (((.(((.(((……..)))))).))).(((…..(((((..((((((..(………………………………..)..))))))..)))))…..)))…((((((….)))).))
RS 1 seq CAUACUACAGGAGUAGUGGGAAAUAAUGUGUAAAUCAUUGGCUGUACUCGCAACGGUAAAAAAAGCCCGGAAACCACAUAAAGUAUACCACUGUUGGAUGAAGACCGAGAAAAGUCACGUUCCACAAUUUUCAU
RS 1 dot ..((((((….))))))((((((((((((….((.((((((.((.((.(((((((…………………………..))))))))))).)).))))))…..))))))…..))))))..
RS 2 seq UAUAAGAGAGUGUUUAACAAUUAAAUAGUUUCAUGUUUGGGGAAGUGAGGUGAGAAUCCUCCACAGUGCCGCUACGGUAAUCCAAGGCUCUAAAGCCAAGGAAAGUCCGAAUACCAAUCAUGAAGUAAGUCCCGAG
RS 2 dot …..((((.(((((((…))))))).))))……((.(..((((((…….)))).))..).))….(((…(((..((((….))))..)))….)))………………………
RS 3 seq AAUGUUUUGUCUUCUUAUGAUAAAGUAAAAAUGAUUGGGGAAGCGAGGUGAAAAUCCUCCGCAGUGCCGCUACGGUAAUCCAUAGAAUAAACUUCUAUGGUAAGCCCGAAUGCCAAUUAUAAAUUGAAGCAUUUG
RS 3 dot ….(((((((…….)))))))………..((.(..((((((…….)))).))..).))…..(((…((((((((…..))))))))…)))((((((((((((…)))))..)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table