Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA097584 Similarity: 0.974 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA097584
Gene: SGCE_0
MFE: -27.636
ENS: 0.727
Length: 113.
Predicted Ligands:
TPP - 9/20
glycine - 5/20
SAM - 3/20
RS: URS0000C65F26_1423739
MFE: -24.220
Ligand: tetrahydrofolate
Species: Lactobacillus diolivorans DSM 14421 THF riboswitch
RS: URS0000C752CB_1641393
MFE: -26.159
Ligand: molybdenum
Species: Clostridiales bacterium 38_11 Moco (molybdenum cofactor) riboswitch
RS: URS0000D8CE1B_89968
MFE: -28.226
Ligand: SAM
Species: Hymenobacter gelipurpurascens SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA097584 URS0000C65F26_1423739 URS0000C752CB_1641393 URS0000D8CE1B_89968
Length 113. 113. 114. 114.
Similarity - 0.974 0.969 0.968
Ensemble Norm 0.727 - - -
MFE -27.636 -24.220 -26.159 -28.226
Ligands - tetrahydrofolate molybdenum SAM
Gene SGCE - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 15. 8.
Length SE - 0. 1. 1.
Lev Distance - 33. 35. 39.
UBS 6. 5. 8. 6.
BS 0. 0. 0. 0.
ILL 4. 2. 5. 3.
ILR 4. 4. 3. 3.
H 2. 1. 1. 1.
BL 0. 1. 2. 2.
BR 0. 0. 2. 1.
UN 0.044 0.088 0.035 0.035

Sequences

Field Description
UTR seq + 25 augcugaugcugaacuggccaagcugggagggaagaagaaagggaggggaggggagaaucgaggacggacggccuagccaggccaagaATGCAATTGCCCCGGTGGTGGGAGC
UTR dot + 25 ..((…(((…..(((((..((((((..(………………………………..)..))))))..)))))…..)))…))((((….))))…
RS 1 seq UAUGGAGUAGGAUUCAACGCGUUAAGUGUCGAAGGAACGGAAUGUGAACUUCGAACGAAAAGUAAUGAUGCGACUUAUUAAUUACUUGCGGUGUUGUUUCCGCAUUCGCCAAU
RS 1 dot ….((((.(((..((((((..((((((((((((…………..))))))……………………….))))))..))))))..)))..))))……
RS 2 seq UUGAAUACUUAGCUCCGAUCUGCAAAUCCUAAGGGGAACUAUGGUUUGCAGACGAUAGGUCUAUCUGAAAACGGGUACACCUCCCAGUAGGAAAGGAGAUAAUGGUUGAUUCUA
RS 2 dot ..(((…((((((…((((.(…(((((..((((………………..(((.((((((….)))))).)))))))..)))))..).))))…)))))))))..
RS 3 seq UACUUAUCCAGAAAGACCGAGGGAUUGGGCCCUAUGACGUCUUAGCAACCUGAAAUAAAACAAGGUGCUAAUUCCCUUUUCAAACCGUUUCGGCGGUCUGGAAGAAGAUAAGAA
RS 3 dot ..((((((…..((((((..(((.(((………….(((((.((((………..)))))))))………….))).)))..))))))…….))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table