Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA097764 Similarity: 0.953 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA097764
Gene: SGTA
MFE: -74.971
ENS: 0.889
Length: 172.
Predicted Ligands:
Mg2+ - 9/20
glucosamine - 4/20
FMN - 3/20
 RS: URS0000C06ADF_1385510
MFE: -57.197
Ligand: glucosamine
Species: Pontibacillus halophilus JSM 076056 = DSM 19796 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D803E8_225345
MFE: -44.865
Ligand: Mg2+
Species: Clostridium chromoreductans M-box riboswitch (ykoK leader)
 RS: URS0000D93C62_1122209
MFE: -65.880
Ligand: Mn2+
Species: Marinospirillum alkaliphilum DSM 21637 yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA097764 URS0000C06ADF_1385510 URS0000D803E8_225345 URS0000D93C62_1122209
Length 172. 172. 172. 171.
Similarity - 0.953 0.952 0.952
Ensemble Norm 0.889 - - -
MFE -74.971 -57.197 -44.865 -65.880
Ligands - glucosamine Mg2+ Mn2+
Gene SGTA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.009 7.002 5.
Length SE - 0. 0. 1.
Lev Distance - 63. 61. 61.
UBS 13. 12. 13. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 1.
ILR 4. 4. 4. 2.
H 4. 4. 5. 4.
BL 3. 3. 4. 3.
BR 4. 4. 3. 4.
UN 0.041 0.134 0.087 0.053

Sequences

Field Description
UTR seq + 25 gcagaagggaagcaacuccgggcgccuuucuuuugcgcaggcgucgcgcccuggggccggggccgggcggcaccgcggugcgcaagcgcaaccgucggugggucggggaucggucgccugagagguaucaccucuucugggcucaagATGGACAACAAGAAGCGCCTGGCCT
UTR dot + 25 ((((((((((.((……….)).))))))))))…..((((..((((((….))))))..)))).((((((((((((….)))).))).)))))((((((((.((.((((((((((((((…)))))))..))))….))).)))………..))))))).
RS 1 seq UCCAUUCUAAAAGCGCCUGGACUAUUUCCGAAAACGGAUUGGGAGAUAGUUGACGAGGAGGAGGUUCAUCGAGAAUCGGCGGAUGCCUCCCGGCUGACGUACUUCAGCUGAUACGUACUCCCCUGAAAACAAAGAGGUGACUCUUUGCACAAGGGUGGAUACAAAGUACAAC
RS 1 dot ……………(((.((((((((((.((……)).)))))))))…).))).((((((((.((((…)))).))..))))))(((((((……)))))))….((((((((((…..(((((((….)))))))…..))).)))……))))…
RS 2 seq UAAUAUCUUUGUUAGGUGAGGCUCCUAUAUAGAUACAUGCUGCUGCCCGGAAACGUCGAGAGACGCCAAUGGGUCAACAGGUAUUACCGGAUUAAGGUUCUACUUAAUGUAGCCGAAAGCCAUUUGGUUUUCUAUGCUAUAUAGUGCUAAAACUCAACGAGUGAAGGCGAAC
RS 2 dot …(((((.((.((((…….)))))).)))))….(((.((((((….((((….))))….)))).)).)))(((..(((…….)))..)))…(((((((.(((((((….)))))))…)))))))..((((…(((…..)))…))))…
RS 3 seq GGGGAGUAGUUGCUUUGUAAAUCCCUGAUUCCGCAAAGAUUGGUGUCAACAUAUUUGAUCCUCAAUGAUCAUGGCACCAAUAGCCUUUCUCAAGGCCUGACGAGACCUGAACACAAGACACCAGCCGGGGCUGGCGGUGCUUUGUGUUCAGUUUUUGAUCUUGUCGGCCAG
RS 3 dot (.(((((((((((…))))….)).))))).)….((((((((((…….(((((……))))))))))))))).(((((….)))))(((((((((((((((((((((.((((.((((….)))))))).)))))))))))…..).)))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table