Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA097766 Similarity: 0.946 Similarity: 0.941 Similarity: 0.940
UTR: 5HSAA097766
Gene: SGTA_0
MFE: -89.471
ENS: 0.926
Length: 187.
Predicted Ligands:
lysine - 10/20
cobalamin - 8/20
Mn2+ - 1/20
 RS: URS0002321027_499207
MFE: -47.464
Ligand: cobalamin
Species: Syntrophaceticus schinkii Cobalamin riboswitch
 RS: URS0000AB8DFF_1088721
MFE: -96.479
Ligand: Mn2+
Species: Novosphingobium pentaromativorans US6-1 yybP-ykoY manganese riboswitch
 RS: URS0002325F1C_1803498
MFE: -54.027
Ligand: cobalamin
Species: Actinobacteria bacterium CG2_30_50_142 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA097766 URS0002321027_499207 URS0000AB8DFF_1088721 URS0002325F1C_1803498
Length 187. 186. 189. 186.
Similarity - 0.946 0.941 0.940
Ensemble Norm 0.926 - - -
MFE -89.471 -47.464 -96.479 -54.027
Ligands - cobalamin Mn2+ cobalamin
Gene SGTA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.012 8. 14.
Length SE - 1. 4. 1.
Lev Distance - 66. 69. 71.
UBS 14. 15. 13. 14.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 3. 4. 3. 5.
H 4. 5. 5. 5.
BL 3. 5. 2. 5.
BR 5. 4. 3. 3.
UN 0.043 0.151 0.042 0.065

Sequences

Field Description
UTR seq + 25 cauuaacgcgccugugcagaagggaagcaacuccgggcgccuuucuuuugcgcaggcgucgcgcccuggggccggggccgggcggcaccgcggugcgcaagcgcaaccgucggugggucggggaucggucgccugagagguaucaccucuucugggcucaagATGGACAACAAGAAGCGCCTGGCCT
UTR dot + 25 ……(((((((((((((((((((.((……….)).))))))))))))))))).))(((((…(((….)))))))).((((((((((((….)))).))).)))))((((((((.((.((((((((((((((…)))))))..))))….))).)))………..))))))).
RS 1 seq AUCGAUAAAAUGAUAACAGGUGCCCAUAAGGGAGAAUAGGGAAUCAGGUGUAAAUCAUUGAGCGGUCCCGCCACUGUAACCAGGGAUAAACCUGCAGGAUACCACCAGACCGGCUUAACCGGCCUGGGAAGGUGCAGGGGAGGAUGAACUGGAAGCCAGGAGACCUGCCUGUUGUCACGAGCUAAA
RS 1 dot ……..((((((.((((((.(((………….))).)))…)))..))))))..(((….)))(.(((….((((……))))))))……((((.((((…..)))).))))….((((((((.(((…..((((…))))….))).)))..)).)))……..
RS 2 seq CACCCCGUCAUCUGGGGAGUAGCCAGCUGGCGUCUGUGCAAGCGGACCGUCAGUGCCCUGUCGUCAACAUACUUGGUCGAGAGACCAUGGCGCACAGGAGAACGGGCAACCGUUCGGGCGAGACCAAUGGCGUUGCAGCUCCGCUCGGCCGGGCGGGUUCUGCCACGCUAUUGUCUUGUCUGUCGCCCG
RS 2 dot ..(((((…..)))))….((..((((((((((((….)))))).))))))))((((((((((…….(((((….)))))))))).))))).((((((….))))))((((((((((((((((((.((((.(((((((….)))))))..)))).)))))))))….)))..)))))).
RS 3 seq UUUGCGUUCGGGUAAAACUGUGAUAUACCGGCGCAUAGUCAGGGAAGCUGGUGAAAGUCCAGCGCGAGCCCGUCACUGUAACCGGGGAGUAAGCCGCGGUAUGCCACUGGUUUCGUUUGAAACCGGGAAGGCGUUGGUAAACAAAGAUCCGGAAGCCAGGAGACCUGUAAAUUCACGUAACGACCA
RS 3 dot .((((((.(((((….(((.(((.(((((((…………..)))))))…))))))…..)))))..)).))))(((.((……)).))).(((((.((((((((….))))))))…))))).(((……..)))(((((..((((…))))….))).))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table