Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA097772 Similarity: 0.952 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA097772
Gene: SGTA_1
MFE: -79.771
ENS: 0.924
Length: 169.
Predicted Ligands:
glucosamine - 7/20
cobalamin - 6/20
FMN - 4/20
 RS: URS0000C6A404_592678
MFE: -74.806
Ligand: cobalamin
Species: Amycolatopsis halophila YIM 93223 Cobalamin riboswitch
 RS: URS000231EAE8_1802292
MFE: -58.326
Ligand: cobalamin
Species: Syntrophus sp. RIFOXYC2_FULL_54_9 Cobalamin riboswitch
 RS: URS0000DB471B_1897015
MFE: -50.392
Ligand: glucosamine
Species: Roseburia sp. 40_7 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA097772 URS0000C6A404_592678 URS000231EAE8_1802292 URS0000DB471B_1897015
Length 169. 168. 170. 167.
Similarity - 0.952 0.949 0.948
Ensemble Norm 0.924 - - -
MFE -79.771 -74.806 -58.326 -50.392
Ligands - cobalamin cobalamin glucosamine
Gene SGTA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 13.004 10.
Length SE - 1. 1. 4.
Lev Distance - 59. 59. 58.
UBS 15. 15. 14. 13.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 3.
ILR 2. 3. 3. 2.
H 4. 3. 5. 3.
BL 4. 5. 4. 3.
BR 8. 6. 5. 8.
UN 0.047 0.113 0.112 0.048

Sequences

Field Description
UTR seq + 25 cauuaacgcgccugugcagaagggaagcaacuccgggcgccuuucuuuugcgcaggcgucgcgcccuggggccggggccgggcggcaccgcggugcgcaagcgcaaccgucggugggucggggaucggucgccugagagguaucATGGACAACAAGAAGCGCCTGGCCT
UTR dot + 25 ……(((((((((((((((((((.((……….)).))))))))))))))))).))(((((…(((….)))))))).((((((((((((….)))).))).)))))((((((((.((.((.((((((……))).)).).))..))..).))))))).
RS 1 seq AAGAGGGAACCCGGUGCGAAUCCGGGACUGCCCCGCAGCGGUGUGCGGGAACGAACGCCGUGCCCGGUCGCGACCGGGACCGCACUGGACCGACACGGUCUGGGAAGCGACGGCUAGUAGGAACGCUCGGCCUGUUGAGCCGGGAGACGUCCGCGAGUCCGAAGACCU
RS 1 dot ………((((((((((..(((((((.((((((((……))))))…….)).)).))))))))).))))))..(((.((((((((…))))))))…))).(((((.((.((.((((((((((….).))))))…))))))).)).)))…….
RS 2 seq UCAUAGAAGAUCGAGGUGGAUGUGUGGAAGGGGGGUGAGAUUCCCCCGCUGCCCCGCAGCCGUGAAGGGAACGAAAGCCCGAAAAGCCACUCUCGCGAGGGAAUCGUGAGGGGAAGGCGGGCGAGUAGGCGGCCCGAAGCCGGAAGACCAAUCCACCGACAGCAUUCCCG
RS 2 dot ……….(((.(((…((((.((.(((((((…….))))).)).)).))))))).))).(((……..)))…..(((.(((((((((…..)))))))))…)))((((………))))((((((((..((….))..)))…)).)))…
RS 3 seq UUAGAAACUUUAGCGCCAUGCACCAGUGGGGUACGGAUACAUACACUGGUUGACGAGGAUUCAGGUUAUCGAAGGUUCGGCGGAUGCCUGAACGUGACAGGCGGUCACGUAUGCAGCAGUCAAAAAGAAAAGGUGACUUUUUAACAAAGCUUCUGCAAACCGCCUGA
RS 3 dot …(((((((…..((.((((((((((……………))))))).).)).))….))))).))..(.(((((((….))).)))).)..((((((((……(((((.(((……((((((….))))))……))).))))).)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table