Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098130 Similarity: 0.972 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA098130
Gene: SHOX2
MFE: -36.421
ENS: 0.803
Length: 122.
Predicted Ligands:
TPP - 8/20
glycine - 5/20
molybdenum - 4/20
 RS: URS0000DA7056_1817761
MFE: -40.324
Ligand: guanidine
Species: Candidatus Muproteobacteria bacterium RBG_19FT_COMBO_61_10 Guanidine-I riboswitch
 RS: URS0000C1D67C_1660103
MFE: -46.023
Ligand: glycine
Species: Kaistia sp. SCN 65-12 Glycine riboswitch
 RS: URS0000D8F73C_1797746
MFE: -37.793
Ligand: glycine
Species: Curvibacter sp. GWA2_63_95 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098130 URS0000DA7056_1817761 URS0000C1D67C_1660103 URS0000D8F73C_1797746
Length 122. 121. 123. 124.
Similarity - 0.972 0.966 0.966
Ensemble Norm 0.803 - - -
MFE -36.421 -40.324 -46.023 -37.793
Ligands - guanidine glycine glycine
Gene SHOX2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.001 4. 3.
Length SE - 1. 1. 4.
Lev Distance - 29. 42. 39.
UBS 11. 9. 12. 12.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 4.
ILR 3. 3. 2. 3.
H 2. 2. 2. 2.
BL 4. 4. 4. 5.
BR 6. 3. 5. 6.
UN 0.074 0.107 0.089 0.089

Sequences

Field Description
UTR seq + 25 ggacaugggcgccgccgagagaagcagggagccgggcagcccgcgacugacggagguguccccggagcugaaagaucgcaaagaggaugcgaaagggATGGAAGAACTTACGGCGTTCGTCT
UTR dot + 25 ……(((((((.(((..((..((.((..((…))..)).))..))..))).)))).)))((((((((.(((.((……………………..)).))).)))).))))…
RS 1 seq UGAAUGGAUGGCUAGGGUUCCGGCUCCUGUGAGCGACUGGUCCAAGAGCCAUCGACCUUGAACGACCCGGGCGGAUCCGGGGAAGGUUGGGGUUACACGGCGGGAUAAAAGCCCGGGAGAC
RS 1 dot ……..((..(((((((..(((((.((.((.(….).)))).)))))…)))))))..)).(((((((..((((.(………………..).))))….)))))))….
RS 2 seq CGGCGACACUCUGGAAAGCAGCCCGAUCCGGGAUUCCGGCGAUGGGCUCACCGAAGGAGUAGCCGCGUCUGUCGCAUCGGCAGAAGCGGGAAAUCUCUCAGGUUCUCGGACAGAGGGGGCGCG
RS 2 dot …….(((((((…(.((((((..((((….))))…))))))).))…))))).(((.(.((((((….((..((((.(((((….)))).).)))))))))))).).)))…
RS 3 seq CGACACCCCACUGGAGAGAGGCCGCAAACUUUGCAGCCCACCGAAGGAGCAACCCGCAGUCUGCGCACCCCUCGUGCAUGCAGGCCCGGCGAAUCUCUCAGGUAAAGCGGACAGCGGGGGCAGC
RS 3 dot …….((..(((…(.(((.((((…)))).)))).)))..)).((..(((((.((((((..((((.(((.((……)).))).)………)))…)))))).))))).))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table