Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098304 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA098304
Gene: SIM2
MFE: -31.676
ENS: 0.807
Length: 81.
Predicted Ligands:
zmp-ztp - 15/20
TPP - 2/20
SAM - 2/20
 RS: URS0000C2AFA1_272562
MFE: -16.998
Ligand: zmp-ztp
Species: Clostridium acetobutylicum ATCC 824 ZMP/ZTP riboswitch
 RS: URS0000C153E5_521098
MFE: -26.122
Ligand: zmp-ztp
Species: Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446 ZMP/ZTP riboswitch
 RS: URS0000D40A76_2756
MFE: -23.460
Ligand: TPP
Species: Brochothrix thermosphacta TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098304 URS0000C2AFA1_272562 URS0000C153E5_521098 URS0000D40A76_2756
Length 81. 81. 81. 81.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.807 - - -
MFE -31.676 -16.998 -26.122 -23.460
Ligands - zmp-ztp zmp-ztp TPP
Gene SIM2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.044 3.015 1.
Length SE - 0. 0. 0.
Lev Distance - 19. 19. 20.
UBS 5. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 1. 1. 0. 1.
BR 0. 1. 1. 1.
UN 0.086 0.296 0.210 0.099

Sequences

Field Description
UTR seq + 25 ggggcuccgcgggccuggagcacggccgggucuaauaugcccggagccgaggcgcgATGAAGGAGAAGTCCAAGAATGCGG
UTR dot + 25 ..(((((((.((((((((…….))))))……..)))))))))….((((…..(((….)))…..)))).
RS 1 seq AGAAAAUCAUGCAACUGGCGGAAAUGGAGUUCACCAUAGGGAGCAUGAUUAAUAUAAGAAUCGACCGCCUGGGUAAAUUAA
RS 1 dot ….((((((((..((((.(((…….))).)))…)..))))))))………….(((…..)))…….
RS 2 seq GUUCCGCUGUGCGACUGGCGGCUUAGCGUGGAGCACCACGAGGAAGCACAGCGAUAUCUGCCGACCGCCUGGGCCCGACGC
RS 2 dot ….((((((((..((((..((((……)))).)))….)..))))))))……(((………)))…….
RS 3 seq CCACUAGGGGGCCUUUUUUAAGGCUGAGAUAGGUUUGUCCUGACCCUUGGACCUGAUCUGGUUAGUACCAGCGGAGGAAAU
RS 3 dot …(((((((((((.(((((….))))).))))………))))))).(((…(((((….)))))…)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table