Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098449 Similarity: 0.957 Similarity: 0.956 Similarity: 0.955
UTR: 5HSAA098449
Gene: SIRT5
MFE: -28.759
ENS: 0.978
Length: 153.
Predicted Ligands:
glucosamine - 13/20
cobalamin - 2/20
Mn2+ - 2/20
 RS: URS0002330963_1801946
MFE: -36.922
Ligand: cobalamin
Species: Planctomycetes bacterium RIFCSPLOWO2_12_38_17 Cobalamin riboswitch
 RS: URS0000C809F6_1402860
MFE: -49.203
Ligand: Mn2+
Species: Bacillus enclensis yybP-ykoY manganese riboswitch
 RS: URS0000BE8D16_1262772
MFE: -29.390
Ligand: glucosamine
Species: Clostridium sp. CAG:1219 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098449 URS0002330963_1801946 URS0000C809F6_1402860 URS0000BE8D16_1262772
Length 153. 152. 152. 155.
Similarity - 0.957 0.956 0.955
Ensemble Norm 0.978 - - -
MFE -28.759 -36.922 -49.203 -29.390
Ligands - cobalamin Mn2+ glucosamine
Gene SIRT5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 5.004 15.
Length SE - 1. 1. 4.
Lev Distance - 52. 56. 49.
UBS 8. 9. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 1. 3. 0. 3.
H 3. 4. 4. 4.
BL 0. 2. 1. 2.
BR 2. 1. 1. 0.
UN 0.150 0.145 0.217 0.161

Sequences

Field Description
UTR seq + 25 gggguuggaaaguaaucccacccgagcagauucaaauauauuagaaagcagccguggagacaaccaucuucauuuugggagaaauaacuaaagcccgccucaagcauuagaacuacagacaaacccugATGGGGAGCAAGGAGCCCAACGCCG
UTR dot + 25 (((((((…..))))))).((((((………………………(((((((……)))))))))))))………….(((((((((…((((((……………))))))))).))..)).))………
RS 1 seq GGGAAUCCCGUAGAGACGGGAGCUGCCCCGCAACUGUAAUCGGCGACGAAAUCUGCAAUAUGCCACUAUUUCAAAAUUUGAUUUGAGAUGGGAAGACGCAGAGAGUAGGAAGACCCGGAAGCCAGGAAACCUAUUUGAACAUUAUUUUUAUG
RS 1 dot (((..((((((….))))))….)))(((………..)))……(((((…….(.((((((((((……)))))))))))…..)))))(((((((….((.((…)).))…)))))))…………….
RS 2 seq CUACCUGUCAAAGGGGAGUAGCUAUAGGCUUCGGCCUAAACAAAGUCGUCAUUUCAUGGAUAUCUCCAUCGGCUUUGUUGGCAUUUUGAACAAUGCUAAGCAAGACCUUUGCCUUUAUUGGGCAAGGGUCUUUUUUAUUUUAUGAAAUUCCU
RS 2 dot …(((…..)))(((((……..))))).(((..((((((((((…….(((((….))))))))))))))))))…………..((((.(((((((((((((…..))))))))))))).))))……………
RS 3 seq AUAAUUGAAAUAGCGCAUGAGUGUUAUAAAACACUGACGAGGAUAACAAGUGUCGAACUUUCAGCGGAUCUUGUUACGGAGUUUGGUAUUAUACGUAAAGUAUGUUUUAAAAAUUCAAAUCGAAGAUGAAUACAAAGAACAUACUAAAUACUUAA
RS 3 dot ………(((((((….)))))))…(((((………….)))))((((((((.((((…..))))..))))))))………(((.((((((((((….(((((………)))))….))))))))))…)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table