Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098484 Similarity: 0.982 Similarity: 0.981 Similarity: 0.979
UTR: 5HSAA098484
Gene: SIRT6
MFE: -28.749
ENS: 0.941
Length: 85.
Predicted Ligands:
GMP - 9/20
cyclic-di-GMP - 5/20
zmp-ztp - 3/20
 RS: URS0000D6A901_12908
MFE: -22.932
Ligand: cyclic-di-GMP
Species: unclassified sequences Cyclic di-GMP-II riboswitch
 RS: URS0000AB18C8_641107
MFE: -17.365
Ligand: cyclic-di-GMP
Species: Clostridium sp. DL-VIII Cyclic di-GMP-II riboswitch
 RS: URS0000D6B21B_12908
MFE: -31.914
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GCG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098484 URS0000D6A901_12908 URS0000AB18C8_641107 URS0000D6B21B_12908
Length 85. 86. 84. 86.
Similarity - 0.982 0.981 0.979
Ensemble Norm 0.941 - - -
MFE -28.749 -22.932 -17.365 -31.914
Ligands - cyclic-di-GMP cyclic-di-GMP GMP
Gene SIRT6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 13.001 2.011
Length SE - 1. 1. 1.
Lev Distance - 22. 20. 26.
UBS 7. 6. 5. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 0. 1. 2. 0.
H 3. 3. 3. 3.
BL 2. 1. 0. 3.
BR 1. 2. 0. 2.
UN 0.165 0.163 0.131 0.058

Sequences

Field Description
UTR seq + 25 gcuuccggcggaagcggccucaacaagggaaacuuuauuguucccguggggcagucgaggATGTCGGTGAATTACGCGGCGGGGC
UTR dot + 25 ((((((…)))))).(((((.((..(((.(((……)))))))))))))………((((((((…))).)))))….
RS 1 seq CGAAGCAGUAGAGGCUUGGAAGUUCGCCCCAAAGAUGGGCGCUUACGGGACGGACAGAGUCAGUGGCGCAACCUGCUACUUCAUAA
RS 1 dot (.((((…….)))).)..((((((((..(((…….)))..))).)))))……(((((((…..)))))))……
RS 2 seq ACACGGAUUGGGAACUGUGAGGGAUUCUCUCUAUUUGGGCAUCUGGAGGAUUCUUAGUUAAUGAUGCAACCCGCCAAUCAAAAC
RS 2 dot .(((((……..)))))(((((((((((..((……))..)))))))))))……((((((…..))..))))….
RS 3 seq UCCGUUCUGGGAGGCGUUGAAACGCGUGCUCGUGUUCCGGUCGCCUGAGCCGCGUUGAGCCACUGGCGAGCCCGACCCCGUUCGCA
RS 3 dot (((……)))(((.(…((((((.(((((.((…….)).)))))))))))).)))….((((((……..)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table