Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098485 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA098485
Gene: SIRT6_0
MFE: -34.
ENS: 0.894
Length: 90.
Predicted Ligands:
glycine - 17/20
cobalamin - 1/20
Mg2+ - 1/20
 RS: URS0000ABBFC3_1231342
MFE: -35.
Ligand: glycine
Species: Acetobacter orleanensis JCM 7639 Glycine riboswitch
 RS: URS00022BF738_2845820
MFE: -26.529
Ligand: glycine
Species: Rhizobium sp. CECT 9324 Glycine
 RS: URS0000DA2052_887144
MFE: -24.729
Ligand: glycine
Species: Rhizobium sp. CCNWSX0483 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098485 URS0000ABBFC3_1231342 URS00022BF738_2845820 URS0000DA2052_887144
Length 90. 90. 88. 88.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.894 - - -
MFE -34. -35. -26.529 -24.729
Ligands - glycine glycine glycine
Gene SIRT6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.001 4.001
Length SE - 0. 4. 4.
Lev Distance - 21. 19. 19.
UBS 8. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 2.
ILR 4. 4. 3. 3.
H 1. 1. 1. 1.
BL 2. 3. 1. 1.
BR 2. 1. 2. 2.
UN 0. 0. 0.023 0.023

Sequences

Field Description
UTR seq + 25 gccccgcuuccggcggaagcggccucaacaagggaaacuuuauuguucccguggggcagucgaggATGTCGGTGAATTACGCGGCGGGGC
UTR dot + 25 (((((((((((((((….((((..(..((.(((.(((……)))))).))..)..))))….)))))).)……..))))))))
RS 1 seq UGACCGCGCAGAGGGAGAGACCGGUCCUGCACCGGCGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCAAAAGGACCCUGCGCGGUUA
RS 1 dot (((((((((((.(((((((.((((..((((.((………)).)))…)..))))…)))))………..)))))))))))))
RS 2 seq ACGACCUUGUUGGGAGAAGCCGGUUCAAUCCGGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCAAAAGGACCACAAGGCGUCG
RS 2 dot (((.((((((((((((…((((…….(((((((….).))).)))..))))…))))))…………)))))))))..
RS 3 seq AUGACCUUGUUGGGAGAAACCGGUUCGAUCCGGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCAAAAGGACCACAAGGCGUCG
RS 3 dot (((.((((((((((((…((((…….(((((((….).))).)))..))))…))))))…………)))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table