Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098687 Similarity: 0.957 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA098687
Gene: SLC10A4
MFE: -68.182
ENS: 0.909
Length: 155.
Predicted Ligands:
FMN - 8/20
cobalamin - 5/20
glycine - 2/20
 RS: URS00023138DD_1305826
MFE: -49.804
Ligand: cobalamin
Species: Streptomyces sp. Amel2xC10 Cobalamin riboswitch
 RS: URS000231294E_1618776
MFE: -27.565
Ligand: cobalamin
Species: Candidatus Nomurabacteria bacterium GW2011_GWF2_40_12 Cobalamin riboswitch
 RS: URS0000D8E3AB_1089454
MFE: -58.529
Ligand: FMN
Species: Gordonia terrae NBRC 100016 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098687 URS00023138DD_1305826 URS000231294E_1618776 URS0000D8E3AB_1089454
Length 155. 156. 155. 157.
Similarity - 0.957 0.953 0.953
Ensemble Norm 0.909 - - -
MFE -68.182 -49.804 -27.565 -58.529
Ligands - cobalamin cobalamin FMN
Gene SLC10A4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.001 30. 10.003
Length SE - 1. 0. 4.
Lev Distance - 45. 45. 52.
UBS 16. 14. 13. 15.
BS 0. 0. 0. 0.
ILL 6. 5. 2. 4.
ILR 6. 3. 4. 8.
H 3. 3. 3. 2.
BL 5. 4. 5. 5.
BR 4. 6. 3. 4.
UN 0.077 0.051 0.071 0.025

Sequences

Field Description
UTR seq + 25 agcacgucagcggcgcgcagccggggcucggagaccgacgggcagaacgacgggcggcgacugcggcgaccgcgggacggcgagaggcacgcggcgggaggggaccggaauccgcagcuccggccgcgccATGGACGGCAACGACAACGTGACCC
UTR dot + 25 .((.((((.(((((((((((.((..(((((..(.((….))…..)..)))))..)).))))).)).))))..))))))….(((..(((((.((((..(..(((…))))..)))).))))))))……((..(((….)))..)).
RS 1 seq AAGAUGUAUGCUCAUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUUGUGCACGUCUGUUCCUUCUGUUCCCGGAACAGCCAUGCCCAGGAGUCAGUCCGAGGACCUGCCGACAGCGCACCCGGCCG
RS 1 dot .((((((..((.((.(..((((((.((….((((..(((((…….)))))….)))))).))))))..).)).))))))))..((((((((((((.((..((….)).)).)))).)))…)))))…((((……….))))..
RS 2 seq GGUAAGUAUAUACUAAAUGAGUUCCUUUUUAAAAAUAUAAGAAAUGAUUUGGGGAAACUGGUUAGAUUCCAGUGCAGUGCCGCUACGGUAAGUCCUGAUACGCCAUUUGGCGAGAAGGAACAAGCCCGACUACCAAUCAUUUUACUUGUCCCGAG
RS 2 dot ((((.((((((.((.(((.((((((((…………………..)))))).)).)))))))….))))..))))…..(((..(((((..(.((((….)))))..)))).)..))).(((……………..)))…..
RS 3 seq ACCAGUUCUCGGGGCGGGGUGAGAUUCCCCACCGGCGGUGAUGAGGGUGCGGUGGAUCCGCAUCGUCCAGCCCGCGAGCGCCUGCCACCAGGCAGGGACAGCAGAUUCGGUGCGAAUCCGAAGCCGACGGUCACAGUCCGGAUGCGAGAGAACAGGC
RS 3 dot ….((((.((((((((.(((.(((((((((((..((….))..)))).)).)))))))).))))….)))).))))(((((….(..(((.((((….((((((((.((….))..)))))..)))…))))…)))..)….)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table