Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098856 Similarity: 0.969 Similarity: 0.968 Similarity: 0.968
UTR: 5HSAA098856
Gene: SLC16A9
MFE: -35.543
ENS: 0.788
Length: 134.
Predicted Ligands:
guanidine - 13/20
cobalamin - 1/20
zmp-ztp - 1/20
 RS: URS0000AB59C7_350701
MFE: -57.596
Ligand: guanidine
Species: Burkholderia dolosa AUO158 Guanidine-I riboswitch
 RS: URS0000C0E98A_1168065
MFE: -34.035
Ligand: guanidine
Species: gamma proteobacterium BDW918 Guanidine-I riboswitch
 RS: URS0000AB3E6B_1348852
MFE: -59.296
Ligand: guanidine
Species: Mumia flava Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098856 URS0000AB59C7_350701 URS0000C0E98A_1168065 URS0000AB3E6B_1348852
Length 134. 134. 133. 134.
Similarity - 0.969 0.968 0.968
Ensemble Norm 0.788 - - -
MFE -35.543 -57.596 -34.035 -59.296
Ligands - guanidine guanidine guanidine
Gene SLC16A9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.016 8.003 2.016
Length SE - 0. 1. 0.
Lev Distance - 39. 38. 42.
UBS 9. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 2.
ILR 3. 3. 4. 3.
H 3. 3. 3. 3.
BL 4. 5. 3. 4.
BR 1. 2. 0. 1.
UN 0.194 0.067 0.135 0.067

Sequences

Field Description
UTR seq + 25 aguuugaggccaacacuaggaagugucuggaaccggauccggaggcuucacaaucuauauguugccuccaaaggaccugcagagaaacgccuccugauuuugucuuacaATGGAACTTAAAAAGTCGCCTGACG
UTR dot + 25 …..((((.(((((.((((((((.((((((……)))))).)))))…..)))..)))))))))…(((((…(((.((……)))))…..)))))……………..(((….))).
RS 1 seq CUUCAGGAUCGCUAGGGUUCCGGUCGCACGGCGUCACACGCCGAGCGACGUCUGGUCCGAGAGCAAUCCGGUCUUGCCGCCUGCCUUUGCGAGGCCCCGGCGAGGCUCCACGGAGGGACAAAAGCCCGGGAGGU
RS 1 dot …..((((.(((.(((..((((((((.((((((…)))))).)))))…))))))…))).)))).(((((((((…(((((…)))))..)))))))))(((.(((.(………)))))))…
RS 2 seq AAAAUGGAAAGCUAGGGUUCCGGUUGCGACUAUUUCUAUAGGUAAAGCAACGACUGGUCCGAGAGCUUUCGACCUUCAGAGUACGUGGCUAGGCUGCAAGAAGGUUACACGGCGGGACAAAAGCCCGGGAGAC
RS 2 dot ……(((((((.(((..((((((((..((((….))))…..)))…))))))))…)))))))(((((((…(((.((……)))))..)))))))……((((.(….)))))……
RS 3 seq CUUCAGGAUCGCUAGGGUUCCGGUCGUGCGGCGUUCGCGCCGCGCGAUGGCUGGUCCGAGAGCAAUCCGGUCUUGUCUUCUCCUCGCUUCGAGGAAACGGCGAGGCUCCACGGAGGGAUAAAAGCCCGGGAGGU
RS 3 dot …..((((.(((.(((..((((((((((((((….)))))))))…))))))))…))).)))).((((((((…((((((…))))))…))))))))(((.(((.(………)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table