Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA098858 Similarity: 0.963 Similarity: 0.962 Similarity: 0.962
UTR: 5HSAA098858
Gene: SLC17A1
MFE: -29.997
ENS: 0.772
Length: 141.
Predicted Ligands:
FMN - 17/20
SAM - 1/20
Ni/Co - 1/20
 RS: URS0000DA0E9C_1764278
MFE: -58.051
Ligand: FMN
Species: Rhizobium sp. R72 FMN riboswitch (RFN element)
 RS: URS0000C0AF3E_1736439
MFE: -53.717
Ligand: FMN
Species: Nocardioides sp. Root1257 FMN riboswitch (RFN element)
 RS: URS00019F136D_2653152
MFE: -50.626
Ligand: FMN
Species: Massilia sp. 9I FMN
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA098858 URS0000DA0E9C_1764278 URS0000C0AF3E_1736439 URS00019F136D_2653152
Length 141. 142. 142. 143.
Similarity - 0.963 0.962 0.962
Ensemble Norm 0.772 - - -
MFE -29.997 -58.051 -53.717 -50.626
Ligands - FMN FMN FMN
Gene SLC17A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 12. 9.
Length SE - 1. 1. 4.
Lev Distance - 44. 44. 42.
UBS 10. 10. 9. 11.
BS 0. 1. 2. 1.
ILL 3. 1. 1. 2.
ILR 1. 1. 2. 2.
H 4. 4. 5. 4.
BL 3. 5. 4. 5.
BR 3. 3. 3. 2.
UN 0.099 0.113 0.106 0.098

Sequences

Field Description
UTR seq + 25 auuguguaaaguugagagaaaagucuucacagcggaagaagaaaucacuuuuuugucccgaaucaguggguggaggcaaaacccuucagcaagaagagaagcaacuucagccguguATGCAAATGGATAACCGGTTGCCTC
UTR dot + 25 .(((((…….((((……)))))))))(((.(.((((((….)))))).).)))……..(.((((((……)))))).)…..(((..((((((….((((……..))))……)))))))))
RS 1 seq GUUUGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAUCGAGGCAACUCGGAGCCCGCGAGCGCCUUCCGAAAGGAAGGGUCAGCAGAUCCGGUGCGAUGCCGGAGCCGACGGUAUAGUCCGGAUGGAAGAGAACAAUG
RS 1 dot ..((((((((..((.((((…….)))).))…(((.(((((….))))).))).((..((.((((((….))))))))..))..((((((.((.((((((…….)))))).))))))))….))))))))..
RS 2 seq UCGCGUGCUCUGGGGUCGGUGUAAUUCCGAGCCGGCGGUGACUGAGAGAUCAGAAGUCCGCGACCCGGUCACAGCCAGUGACCGGUUGACCAGGUGAGAAUCCUGGACCGACGGUGAAAGUCCGGAUGGGAAGCGCACGCAG
RS 2 dot ..((((((.((.((.((((…….)))).)).(((((..((((….))))..).))))…((((((((…..))))))))….(((((…….))))).(((.(((…….)))..)))..)).))))))..
RS 3 seq AUACGUCUUCGGGGCGGGGUGAAAUUCCCCACCGGCGGUAUGGCCUGAAAUGGGCCGAGCCCGCGAGCGCCUGUGCAAGCAGGGUCAGCAGAUCUGGUGAGAUGCCAGGGCCGACGGUAUAGUCCGGAUGAAAGAAGAUGUGC
RS 3 dot .(((((((((..((.((((…….)))).))…(((.((((((…..)))))).))).((..((.(((((….)))))))..))..((((((.(..(((((.(……))))))..)))))))….))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table