Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099042 Similarity: 0.980 Similarity: 0.980 Similarity: 0.978
UTR: 5HSAA099042
Gene: SLC22A5
MFE: -7.720
ENS: 0.757
Length: 34.
Predicted Ligands:
SAM - 10/20
preQ_1 - 4/20
unknown - 2/20
RS: URS0001A24B6D_1907202
MFE: -12.438
Ligand: unknown
Species: Chains: A,B,C,D,E,F,G,H,I,J,K,L from Roseobacter sp. (PDB 6YL5, chain G)
RS: URS0000D87AB1_1686310
MFE: -13.459
Ligand: SAM
Species: Bartonella apis SAM riboswitch (alpha-proteobacteria)
RS: URS000080E037_32630
MFE: -4.622
Ligand: preQ_1
Species: PreQ1 riboswitch from None (PDB 3K1V, chain A)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099042 URS0001A24B6D_1907202 URS0000D87AB1_1686310 URS000080E037_32630
Length 34. 35. 36. 34.
Similarity - 0.980 0.980 0.978
Ensemble Norm 0.757 - - -
MFE -7.720 -12.438 -13.459 -4.622
Ligands - unknown SAM preQ_1
Gene SLC22A5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 31.019 31.004 36.055
Length SE - 1. 4. 0.
Lev Distance - 15. 13. 17.
UBS 5. 2. 2. 1.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 1. 0.
H 1. 1. 1. 1.
BL 2. 0. 0. 0.
BR 4. 0. 0. 0.
UN 0.118 0.257 0.056 0.353

Sequences

Field Description
UTR seq + 25 gagggcggcATGCGGGACTACGACGAGGTGACCG
UTR dot + 25 …((((.(.((((……)).)).).)).)).
RS 1 seq GGUCACAACGGCUUCCUGGCGUGACCAUUGGAGCA
RS 1 dot ((((((..(((….)))..))))))………
RS 2 seq CGUGGUGAUUUGGGCCGGCCGGCUUGCAGCCACGCU
RS 2 dot ((((((…..(((((….)))))…))))))..
RS 3 seq AGAGGUUCUAGCACAUCCCUCUAUAAAAAACUAA
RS 3 dot (((((…………)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table