Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099081 Similarity: 0.976 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA099081
Gene: SLC23A3
MFE: -13.022
ENS: 0.722
Length: 105.
Predicted Ligands:
TPP - 18/20
purine - 2/20

 RS: URS0000C68262_1121305
MFE: -15.668
Ligand: TPP
Species: Clostridium colicanis DSM 13634 TPP riboswitch (THI element)
 RS: URS0000DA1682_1962263
MFE: -20.343
Ligand: TPP
Species: Clostridium tepidum TPP riboswitch (THI element)
 RS: URS0000C6CB31_1262760
MFE: -16.798
Ligand: TPP
Species: Brachyspira sp. CAG:700 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099081 URS0000C68262_1121305 URS0000DA1682_1962263 URS0000C6CB31_1262760
Length 105. 103. 103. 104.
Similarity - 0.976 0.975 0.974
Ensemble Norm 0.722 - - -
MFE -13.022 -15.668 -20.343 -16.798
Ligands - TPP TPP TPP
Gene SLC23A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 4.002 2.001
Length SE - 4. 4. 1.
Lev Distance - 27. 28. 33.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 1. 2. 2. 2.
H 3. 2. 2. 2.
BL 1. 0. 0. 1.
BR 0. 0. 0. 0.
UN 0.305 0.340 0.350 0.279

Sequences

Field Description
UTR seq + 25 uucacccaaacucugaccucuuacucucucuacuuaacucuggucccgggcagccaagacaaagcgaaaggcaaggcagcATGAGCCGATCACCCCTCAATCCCA
UTR dot + 25 ……….(((.((((…………………..))))..)))..(((…………..)))..(((…….)))………………
RS 1 seq AAUAUAUUGCAGGGGUGCCCAUUAUGGCUGAGAAGAAUUUAAUUCUAACCCUCCGAACCUGAAUCUAGAUAAUGCUAGCGCAGGAAGCAAUGAGUUAUUAUAU
RS 1 dot ………..((((((((……)))……………….)))))…..((((…((((……))))..))))……………….
RS 2 seq UUUAUGUUCUAGGGGUGCCUCUUUUGGCUGAGAAGAUAAAAUAUCUAACCCUAAUAACCUGAUCCAGGUAAUACUGGCGUAGGAAAGCAACAUAUAAAAUAAU
RS 2 dot ………..((((((((……)))……………….)))))…..((((..((((……))))..))))………………..
RS 3 seq AUUAAUCAAUAGGGGAGCUUUAAAAGGCUGAGAGGAAAUAAAAUAUUUCGACCCUUAUAACCUGUUUGGGUAAUGCCAGCGUAGGGAAUCACUCUCAUAUUAUA
RS 3 dot ……..((((((((((((….)))))………………….)))))))..((((.((((……))))..))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table