Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099083 Similarity: 0.991 Similarity: 0.991 Similarity: 0.991
UTR: 5HSAA099083
Gene: SLC23A3_0
MFE: -6.438
ENS: 0.837
Length: 45.
Predicted Ligands:
preQ_1 - 20/20 - 20/20


RS: URS0000AB979F_435832
MFE: -3.992
Ligand: preQ_1
Species: Neisseria mucosa C102 PreQ1 riboswitch
RS: URS0000DA1BAC_1073325
MFE: -3.987
Ligand: preQ_1
Species: Salegentibacter sp. HD4 PreQ1 riboswitch
RS: URS0000AB2A72_242231
MFE: -3.992
Ligand: preQ_1
Species: Neisseria gonorrhoeae FA 1090 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099083 URS0000AB979F_435832 URS0000DA1BAC_1073325 URS0000AB2A72_242231
Length 45. 45. 45. 45.
Similarity - 0.991 0.991 0.991
Ensemble Norm 0.837 - - -
MFE -6.438 -3.992 -3.987 -3.992
Ligands - preQ_1 preQ_1 preQ_1
Gene SLC23A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 2.002 2.002
Length SE - 0. 0. 0.
Lev Distance - 11. 11. 11.
UBS 2. 1. 1. 1.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 1. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.511 0.556 0.556 0.556

Sequences

Field Description
UTR seq + 25 aaagcgaaaggcaaggcagcATGAGCCGATCACCCCTCAATCCCA
UTR dot + 25 …((…..))..(((…….)))………………
RS 1 seq CACCCCGUGGUUCGAAAACCUCCCACAUUAAAAAACUAAGGAAAC
RS 1 dot ……((((…………))))……………….
RS 2 seq AGACCAGUGGUUCGAAAUUCUCCCACAUUAAAAAACUAAAAAAGG
RS 2 dot ……((((…………))))……………….
RS 3 seq CGCCCCGUGGUUCGAAAACCUCCCACACUAAAAAACUAAGGAAAC
RS 3 dot ……((((…………))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table