Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099252 Similarity: 0.967 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA099252
Gene: SLC25A3
MFE: -55.845
ENS: 0.976
Length: 145.
Predicted Ligands:
FMN - 13/20
cobalamin - 6/20
TPP - 1/20
 RS: URS0002327C7E_1895848
MFE: -54.805
Ligand: cobalamin
Species: Sphingomonas sp. 66-10 Cobalamin riboswitch
 RS: URS0000AB4236_315749
MFE: -34.851
Ligand: FMN
Species: Bacillus cytotoxicus NVH 391-98 FMN riboswitch (RFN element)
 RS: URS0000C6C67A_381
MFE: -53.490
Ligand: FMN
Species: Mesorhizobium loti FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099252 URS0002327C7E_1895848 URS0000AB4236_315749 URS0000C6C67A_381
Length 145. 145. 145. 145.
Similarity - 0.967 0.966 0.965
Ensemble Norm 0.976 - - -
MFE -55.845 -54.805 -34.851 -53.490
Ligands - cobalamin FMN FMN
Gene SLC25A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 8.001 2.
Length SE - 0. 0. 0.
Lev Distance - 39. 41. 46.
UBS 12. 13. 13. 12.
BS 0. 0. 0. 1.
ILL 3. 5. 4. 2.
ILR 2. 4. 3. 2.
H 2. 2. 1. 2.
BL 4. 5. 6. 4.
BR 5. 6. 5. 5.
UN 0.041 0.034 0.014 0.041

Sequences

Field Description
UTR seq + 25 gugugcgucacgccgacgacgcgcgaagggcacacaucuuaggacccggaggacguccggccucugugagccgcaaccuuuccaagggagugguugugugaucgccaucuuagggaaaagATGTTCTCGTCCGTGGCGCACCTGG
UTR dot + 25 ..(((((((……..)))))))..(((((.(.(((….((((…(((((((((….((((((((.((((((((.((((…)))).))))))).).))))……))))….))))))))))))))))).)).)))..
RS 1 seq UUGACGCCGCGGCGCUGCGGCUUCUAGGUCGCGCCUGCACAGAGGAAGAAGAAGCCGGUGAAAGCCCGGCGCGGUCGCGCCACUGUAACCGACACUGCGAAGCGGGGUCGGGAGCCAGACCUUCUCCCUCGGGCGACAAACCUCU
RS 1 dot ..((.((((((….)))))).)).((((.((((((…..((((.(((((…..(((…..((((((.(.((..(((…(((…..)))..)))..)).).)))))).)))….))))).))))))))).)..))))..
RS 2 seq GUCUAUCUUCGGGGCAGGGUGAAAAUCCCGACCGGCGGUAAUGAAUGAGUAUAUGAAUAUGUGAGUUCUAAGCCCGCGAGCCGUUAAGGCAGGAUUUGGUGCGAUUCCAAAGCCGACAGUACAGUCUGGAUGGGAGAAGAUGGAG
RS 2 dot .(((((((((……………(((((.(((((.(((.((..((.((….((((.((((((((((..(((.(((…)))…))))))))))…)))))))….)))).)).))).).)))).)))))))))))))).
RS 3 seq UAAUGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAGAGCCUCGGCUCAAGCCCGCGAGCGCUUCCUGGCAGCAGGAGGGUCAGCAGAUCCGGUGCGAUUCCCGAGCCGACGGUUACAGUCCGGAUGGAAGAGAACGUAC
RS 3 dot ..((((((((.((((………))))((((((((.(((…((((((((((..(((((.((((.(((((((….)))))))))…….))))).))…….))))))).)))))).).)))).)))..))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table