Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099312 Similarity: 0.967 Similarity: 0.967 Similarity: 0.965
UTR: 5HSAA099312
Gene: SLC25A32
MFE: -72.207
ENS: 0.858
Length: 131.
Predicted Ligands:
FMN - 8/20
cobalamin - 4/20
zmp-ztp - 2/20
 RS: URS0002317907_129817
MFE: -49.829
Ligand: zmp-ztp
Species: Pseudomonas brenneri ZMP/ZTP riboswitch
 RS: URS0002332DDE_1619947
MFE: -55.568
Ligand: cobalamin
Species: Terrabacter sp. 28 Cobalamin riboswitch
 RS: URS0000AB9CC7_12908
MFE: -27.881
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099312 URS0002317907_129817 URS0002332DDE_1619947 URS0000AB9CC7_12908
Length 131. 129. 133. 131.
Similarity - 0.967 0.967 0.965
Ensemble Norm 0.858 - - -
MFE -72.207 -49.829 -55.568 -27.881
Ligands - zmp-ztp cobalamin cobalamin
Gene SLC25A32 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 14. 17.003
Length SE - 4. 4. 0.
Lev Distance - 36. 33. 39.
UBS 11. 11. 13. 10.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 3.
ILR 0. 1. 2. 2.
H 4. 4. 4. 3.
BL 5. 4. 6. 4.
BR 4. 6. 5. 3.
UN 0.031 0.047 0.045 0.084

Sequences

Field Description
UTR seq + 25 ggugggguugcgcucacaaggggcgaccgucgccacgguggcggccacugcaucgcgucccaccuccgcggcccugggcgccguggugucgacgggccccgagccuATGACGGGCCAGGGCCAGTCGGCGT
UTR dot + 25 (((((((((((.(((….))))))))).)))))..(((((.((((……..).)))))))).(((((((…….)))))))(((((((.(((((.(.((((…..))))).))))).))))))).
RS 1 seq CCUGCGCCGCCGUACUGGCGCAACUGGCCAGCCUGGACAACGUCUCGCUGAUCACCCUGCCCACCAACCAGGGCAAGGGCGGUGCGGUGCAAGUCGGUUUUCGCGAAGCCGCACGCCUGGGCUUUACCC
RS 1 dot ..(((((((……)))))))..(((.((((..(((…..))).)))).)))((((((((……..))))).))).((((.(((.((.(((((((((…))))))).))…)).))).)))).
RS 2 seq GGCGUCUCGGGCUAUGGUGGCCCCAGCGUCGUCGACCAGGAACCCGGUGAGAGUCCGGGACGGUCCCGCCACUGUGAGCCGUCACCCGCGAGGGAGGCGGUGAGUCAGGAACUGCCGGCAGCGCCUCACCUUC
RS 2 dot ((((.((.((((((…)))))).))))))…((((.(…(((((…….))))).))))).(((….((((….))))..)))(((((((((.((.(.(((…))).)..)).)))))).)))..
RS 3 seq AUACUGAAAAGCAUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUUCCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAUAGACCCCUGUCGAAUGAUGGCCAGGAAAAGCCUAAUUCUACAAUACUUAA
RS 3 dot ….((((…((((.(((….))).))))…)))).((((.(((((.((………)).)))))))))…(((((…….(((.((((…(((……..)))..)))).))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table