Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099254 Similarity: 0.957 Similarity: 0.950 Similarity: 0.949
UTR: 5HSAA099254
Gene: SLC25A3_0
MFE: -69.890
ENS: 0.810
Length: 179.
Predicted Ligands:
cobalamin - 18/20
FMN - 1/20
TPP - 1/20
 RS: URS0002316014_1631356
MFE: -74.829
Ligand: cobalamin
Species: Luteipulveratus halotolerans Cobalamin riboswitch
 RS: URS000232922C_767029
MFE: -67.441
Ligand: cobalamin
Species: Pseudopropionibacterium propionicum F0230a Cobalamin riboswitch
 RS: URS000231FA9A_1869308
MFE: -57.648
Ligand: cobalamin
Species: Desulfuromonadales bacterium C00003093 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099254 URS0002316014_1631356 URS000232922C_767029 URS000231FA9A_1869308
Length 179. 180. 178. 180.
Similarity - 0.957 0.950 0.949
Ensemble Norm 0.810 - - -
MFE -69.890 -74.829 -67.441 -57.648
Ligands - cobalamin cobalamin cobalamin
Gene SLC25A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 22.001 9.001
Length SE - 1. 1. 1.
Lev Distance - 53. 52. 61.
UBS 17. 17. 17. 17.
BS 0. 0. 0. 0.
ILL 4. 4. 2. 6.
ILR 3. 5. 7. 5.
H 3. 2. 2. 2.
BL 6. 5. 7. 6.
BR 6. 6. 6. 6.
UN 0.022 0.011 0.051 0.056

Sequences

Field Description
UTR seq + 25 accaaugggcgacgcguacuugcaguggcgcgcugugugcgucacgccgacgacgcgcgaagggcacacaucuuaggacccggaggacguccggccucugugagccgcaaccuuuccaagggagugguugugugaucgccaucuuagggaaaagATGTTCTCGTCCGTGGCGCACCTGG
UTR dot + 25 .((….))((.(((((.((((..(((((((((…)))))))))..))).)))))))).(((((.(.(((….((((…(((((((((….((((((((.((((((((.((((…)))).))))))).).))))……))))….))))))))))))))))).)).)))..
RS 1 seq UAGCGUUCCCGGCGAGCUGGUCGUACCACGAACGGUGCCAGGGAAUCCGGUGAGACUCCGGAGCUGACGCGCAGCGGUGUGGGUGACGGGCGGAGCACAACGCCACUGGACGAGAGUCCGGGAAGGCGCUCCGUCUGAGUGAUCCCGAGUCCGAAGACCUGCCGGCUCAUGUCAUCGACC
RS 1 dot ..(.(((((((((..((((.((((…)))).))))))).)))))).)((((((((….((((((….(((((((((.((((.(((((((((((…..(((.((((((….))))))…))))))))))))..)).))))))…)))…..))))))))))..))).)).)))
RS 2 seq UGCUACGGUGUGCUCGUCGGUGGCGCCCCAGGCGCCGGGGAACCCGGUGGGAAUCCGGGACUGACGCGCAGCGGUGAGAGGGACCGAACGGGCACGUGGCCACUGGGAGAAAUCCCGGGAAGGCGUCCGCGACGGAAUGAACUCGAGUCCGAAUACCAGCCGACGACGUCAUCCACGC
RS 2 dot …..(((.((.(((((((((((((((…)))))))……)))))))).)))))(((.((((((((.((((((….(((((((.((..(.(((((((.((((((….))))))…)))…))))…)..))…))).))))…)))).)).).)).))))))))….
RS 3 seq UUUAAUCAGUUGUUCAUCGGUGCCCGCAAGGGCUUGAUAGGGAAGAGGGGUGCAAAUCCCCCGCGGAUCCGCCGCUGUGAGCGAGGACGAAGGGCUUUAGACCACUGGCCGUAAAGGCUGGGAAGGUGGCCCCGAGGACGAUUCGCGAGCCAGAAGACCUGCCGGAAUGGACACCCACAA
RS 3 dot ……(..((.((.(((((.((((….))))))))).)).))..)(((((….(((.((((((.((….((((((((((….((..(((((….(((.((((((…..))))))…))))))))))….)).))))).)))…..)).)))).))…))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table