Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099255 Similarity: 0.974 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA099255
Gene: SLC25A3_1
MFE: -41.502
ENS: 0.896
Length: 118.
Predicted Ligands:
SAM - 9/20
glycine - 5/20
molybdenum - 4/20
 RS: URS0000C6E79C_1660120
MFE: -39.130
Ligand: glycine
Species: Novosphingobium sp. SCN 63-17 Glycine riboswitch
 RS: URS0000DA5D8D_1978761
MFE: -44.776
Ligand: glycine
Species: Proteobacteria bacterium ST_bin13 Glycine riboswitch
 RS: URS0000D96932_1122159
MFE: -27.756
Ligand: SAM
Species: Leeuwenhoekiella marinoflava DSM 3653 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099255 URS0000C6E79C_1660120 URS0000DA5D8D_1978761 URS0000D96932_1122159
Length 118. 117. 118. 117.
Similarity - 0.974 0.974 0.973
Ensemble Norm 0.896 - - -
MFE -41.502 -39.130 -44.776 -27.756
Ligands - glycine glycine SAM
Gene SLC25A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 5. 10.012
Length SE - 1. 0. 1.
Lev Distance - 32. 33. 31.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 2.
ILR 1. 1. 1. 3.
H 3. 3. 3. 3.
BL 2. 3. 2. 1.
BR 3. 4. 1. 2.
UN 0.076 0.128 0.085 0.188

Sequences

Field Description
UTR seq + 25 cgaagggcacacaucuuaggacccggaggacguccggccucugugagccgcaaccuuuccaagggagugguugugugaucgccaucuuagggaATGTTCTCGTCCGTGGCGCACCTGG
UTR dot + 25 …..(((.((((….(((..(((((…..)))))))).)))).)))((((((.((((…)))).))))))(((..((((((….((((….))))….)))))))))….
RS 1 seq UAGCGACGCUCUGGAAAGUGCAAUCGGACCAAUGGGUUCGGGGGCCGCCGAAGGGGUAAAUCUGCGCAUUCCCAUGCGCGGGCUAAGCUCUCAGGUUUCCGUGACAGAGGGGGCACC
RS 1 dot ……(.((.(((…(.((..(((((((….)))))))..))).))).)).)……((((((((….))))))))(((…(((((..(((…..))).))))))))…
RS 2 seq ACACGACACUCUGGAAAGCGGCUUCGCAAGCGUUUGCGGGGCCCACCGAAGGGGUAAGCCGGCACGCGCUACAAGGCGCGCGGCGAAAGCUCUCAGGUUCCGUGACAGAGGGGCGGCU
RS 2 dot …..((.((((((…(.((((((((((….))))))))))).))..))))))..((((…((((((….))))))))))…((((…..(((((……..)))))))))
RS 3 seq UUGUUAUCAAGAAAGGCGGAGGGAUAGACCCUAUGAAGCCUUAGCAACCCUUUCACUUGGAAGAAGGUGCUACAUUCUACCCCAAAUUUGGAGACAAAACAGCGGGAUAGAUAACUA
RS 3 dot ………….((((..((((…..))))…..))))((((.((((((((….)))))..)))))))…((((((((…((((….))))…).))).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table