Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099298 Similarity: 0.987 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA099298
Gene: SLC25A3_2
MFE: -25.905
ENS: 0.841
Length: 80.
Predicted Ligands:
cobalamin - 5/20
homocysteine - 4/20
SAM - 3/20
 RS: URS0000BEE6DC_999552
MFE: -22.753
Ligand: SAM
Species: Leisingera methylohalidivorans DSM 14336 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D9A353_1895901
MFE: -29.562
Ligand: homocysteine
Species: Nitrosospira sp. 56-18 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB479E_388739
MFE: -18.984
Ligand: SAM
Species: Roseobacter sp. SK209-2-6 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099298 URS0000BEE6DC_999552 URS0000D9A353_1895901 URS0000AB479E_388739
Length 80. 80. 79. 79.
Similarity - 0.987 0.982 0.982
Ensemble Norm 0.841 - - -
MFE -25.905 -22.753 -29.562 -18.984
Ligands - SAM homocysteine SAM
Gene SLC25A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 3. 11.020
Length SE - 0. 1. 1.
Lev Distance - 17. 22. 20.
UBS 6. 5. 7. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 0.
ILR 1. 1. 1. 2.
H 3. 3. 3. 2.
BL 1. 1. 2. 1.
BR 2. 1. 2. 0.
UN 0.113 0. 0.101 0.253

Sequences

Field Description
UTR seq + 25 cucugugagccgcaaccuuuccaagggagugguugugugaucgccaucuuagggaATGTTCTCGTCCGTGGCGCACCTGG
UTR dot + 25 (((…)))((((((((.((((…)))).))))))).)..((((((….((((….))))….))))))…….
RS 1 seq CGCCUCGGGCGUGCGCGAUUUGUUACCGGAUUGCGGGCCACGUAAAACAUUCCCGCUAAAGAGGUCAGGAUGUGAAGGAC
RS 1 dot .(((…)))((.(((((((((….))))))))).))……..((((((..(((…..)))..))))))…….
RS 2 seq CUCGCCGAGGAGCGCUGCAACGGGCACCGUCCCGCGAGGCUCGGCAGGGAGAGUAUCGUAUUAACGGCGCUCGUUCAUU
RS 2 dot (((……)))(.((((..(((((..(((…)))..))))))))).).((((.((((….)))).))))…….
RS 3 seq CGCUCUUUCUGUGGCUGAUUUGUAACCGGAUUGCGGGCCACGUUAAAUAUCCCGCUAAAGAGGUCAGGAUGUGAAGGAC
RS 3 dot ………(((((((((((((….))))))…)))))))….((((((.(((…..)))..))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table