Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099480 Similarity: 0.985 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA099480
Gene: SLC27A3
MFE: -31.989
ENS: 0.793
Length: 69.
Predicted Ligands:
fluoride - 14/20
cobalamin - 3/20
2'-dG-II - 2/20
 RS: URS0000C40E2E_1133569
MFE: -11.509
Ligand: fluoride
Species: Lactobacillus vini DSM 20605 Fluoride riboswitch
 RS: URS0000D929BC_1805218
MFE: -15.327
Ligand: fluoride
Species: Hydrogenophilaceae bacterium CG1_02_62_390 Fluoride riboswitch
 RS: URS0000DB163B_1797820
MFE: -29.468
Ligand: fluoride
Species: Deltaproteobacteria bacterium GWC2_65_14 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099480 URS0000C40E2E_1133569 URS0000D929BC_1805218 URS0000DB163B_1797820
Length 69. 70. 68. 69.
Similarity - 0.985 0.983 0.983
Ensemble Norm 0.793 - - -
MFE -31.989 -11.509 -15.327 -29.468
Ligands - fluoride fluoride fluoride
Gene SLC27A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.039 2.014 13.001
Length SE - 1. 1. 0.
Lev Distance - 19. 21. 19.
UBS 4. 4. 3. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 1. 2. 1. 4.
BR 2. 1. 1. 2.
UN 0.130 0.329 0.250 0.101

Sequences

Field Description
UTR seq + 25 uuucugcucuccgcccguguggaguggugggggccugggugggaATGCCTAAACCGCCCAAGCCGAGAA
UTR dot + 25 …(((((((((((….)))))).))))).(((.(((((((………..))))))).)))…..
RS 1 seq UGAAAUAAAGGUGAUGACGUUCACCUAUUAAAUGAUCGUAAGCAAAUGACCUGAUGACGUCUACUAAACU
RS 1 dot ……..((((((……))))))…..(((.((((.((……..)).)))))))……….
RS 2 seq UUCAAAGCAGGAGAUGGCAUACCUCCUAAUAACCGCCUGGGUUCCCGGCUGAUGAUGCCUACGCGAAC
RS 2 dot ……..(((((………)))))……(((.(((((…………..))))).)))…
RS 3 seq GAAGAUCGGGGUGAUGGGGUUCACCCGGAACCGUCCGCCGGGAGGCGGGCUGAUGACUCCUGCGAUGGC
RS 3 dot …..((.((((((……)))))).)).((((.((.((((((.((……)).)))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table