Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099745 Similarity: 0.986 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA099745
Gene: SLC2A8
MFE: -27.536
ENS: 0.726
Length: 70.
Predicted Ligands:
fluoride - 13/20
cobalamin - 4/20
glycine - 2/20
 RS: URS0000C8358E_1385521
MFE: -27.022
Ligand: cobalamin
Species: Knoellia subterranea KCTC 19937 Cobalamin riboswitch
 RS: URS0000BEE004_134537
MFE: -20.340
Ligand: fluoride
Species: Burkholderia fungorum Fluoride riboswitch
 RS: URS0000D908F9_1834178
MFE: -21.398
Ligand: glycine
Species: Enterococcus sp. 3H8_DIV0648 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099745 URS0000C8358E_1385521 URS0000BEE004_134537 URS0000D908F9_1834178
Length 70. 71. 71. 70.
Similarity - 0.986 0.986 0.985
Ensemble Norm 0.726 - - -
MFE -27.536 -27.022 -20.340 -21.398
Ligands - cobalamin fluoride glycine
Gene SLC2A8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 4.010 3.029
Length SE - 1. 1. 0.
Lev Distance - 16. 17. 19.
UBS 5. 7. 4. 4.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 1. 0. 2.
H 2. 2. 2. 2.
BL 1. 2. 0. 0.
BR 0. 1. 1. 0.
UN 0.071 0.085 0.169 0.243

Sequences

Field Description
UTR seq + 25 ggcgguucaggcgccagagcuggccgaucggcguuggccgccgacATGGTCGTCGTCGGCATCCTCCTGG
UTR dot + 25 ((((…….)))).(((…(((((.(((((…((((……))))))))))))))…)))….
RS 1 seq GGAAAGCCGGUCCAAGUCCGGCGCUGACCCGCAACCGUAGGCCUCCCGUGAGGGCGGCGAGCCGGACCACC
RS 1 dot (((…….)))..(((((((((((.(((.((..((..((…)))))).)))))))..)))))))….
RS 2 seq GCUCAAUCUGGAGAUGGCGUUCCUCCUUUAACCAUCGCGCUUACCGCGCGGUUAAUGACGCCUACAGUUAC
RS 2 dot .(((……)))..((((((……((((((…((((…..)))))))))).))))))………
RS 3 seq CUCUGGAGAGCAGAAAUGCGCCGAAGGAGCAACCCCUGAAAGGGGGGAAUCUCUCAGGCUAGGAACAGGG
RS 3 dot .((((…..))))…..(((…((((…(((((…..)))))…))))..)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table