Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099856 Similarity: 0.976 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA099856
Gene: SLC35A2
MFE: -23.755
ENS: 0.966
Length: 106.
Predicted Ligands:
TPP - 15/20
glycine - 2/20
SAM - 1/20
 RS: URS0000C745B6_1797883
MFE: -32.065
Ligand: TPP
Species: Deltaproteobacteria bacterium RIFCSPLOWO2_02_FULL_55_12 TPP riboswitch (THI element)
 RS: URS0000AB3CB1_585529
MFE: -30.545
Ligand: TPP
Species: Corynebacterium genitalium ATCC 33030 TPP riboswitch (THI element)
 RS: URS0000302199_1125847
MFE: -34.154
Ligand: TPP
Species: Rhizobium sp. NT-26 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099856 URS0000C745B6_1797883 URS0000AB3CB1_585529 URS0000302199_1125847
Length 106. 107. 105. 104.
Similarity - 0.976 0.975 0.974
Ensemble Norm 0.966 - - -
MFE -23.755 -32.065 -30.545 -34.154
Ligands - TPP TPP TPP
Gene SLC35A2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 7.002 4.001
Length SE - 1. 1. 4.
Lev Distance - 31. 30. 28.
UBS 10. 10. 10. 9.
BS 0. 0. 0. 0.
ILL 5. 4. 3. 4.
ILR 4. 4. 3. 3.
H 2. 2. 2. 3.
BL 2. 2. 3. 2.
BR 2. 3. 1. 2.
UN 0.094 0.121 0.133 0.058

Sequences

Field Description
UTR seq + 25 aucgggggaugaucuggaaagcgcgaucagugaagcggacgaacggcaggauaaggcgggucuagugacaggaaugggccgATGAAGCTCTGTAGGGATGCTCACA
UTR dot + 25 ………(((((((…..)).)))))(((.((((..(..((((.((..(…(..((((((……….))))))..).)..))))))..)..))))))).
RS 1 seq AAAUUACGCUAGGGGAGUCCGGACAGGGCUGAGAGUUCCCGCUUGAGGGAAGACCCUAACGACCUGAUCUGGUUAAUACCAGCGUAGGGAAGCGGCUGACAACAAGA
RS 1 dot ………..(((((.(((((……))).)).))))).((((..(..((.((((…..((((..(((((….)))))..))))..)).))))..)..)))).
RS 2 seq GGAUAAGACACGGGGUGCCCAGCCCCCGAUGAGGCCGGGCUGAGAUUACACCCGUUGAACCUGAUCGAACUCGAAUUCGCGGAGGAAUUGUCUGAUGGCCGAACG
RS 2 dot ……..(((((((.((…))))))).)).((((((((…((((.(..(((.((((..(((……)))..)))))))..)))))))))…))))…..
RS 3 seq CGGUAUUCCGAGGGGGGCAUCGUAACGGUGCUGAGAUGGCGGUGAGCCGGACCCUUGAACCUGAUCCGGGUCAUACCGGCGUAGGAACGGAAACGGCCUUUUCG
RS 3 dot (((….)))…..(((((((…)))))))((((.(((.((…(((..((..((……..((((……))))))..))..)))..)).))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table