Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA099878 Similarity: 0.955 Similarity: 0.955 Similarity: 0.955
UTR: 5HSAA099878
Gene: SLC35A5
MFE: -56.469
ENS: 0.876
Length: 158.
Predicted Ligands:
SAM - 14/20
glucosamine - 3/20
Mg2+ - 1/20
 RS: URS0000D7D20D_1703927
MFE: -68.450
Ligand: SAM
Species: Streptomyces sp. CB00455 SAM riboswitch (S box leader)
 RS: URS0000D7AD2A_1415554
MFE: -68.750
Ligand: SAM
Species: Streptomyces sp. WM6368 SAM riboswitch (S box leader)
 RS: URS0000C14676_1262452
MFE: -73.383
Ligand: SAM
Species: Streptomyces sp. 769 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA099878 URS0000D7D20D_1703927 URS0000D7AD2A_1415554 URS0000C14676_1262452
Length 158. 158. 159. 158.
Similarity - 0.955 0.955 0.955
Ensemble Norm 0.876 - - -
MFE -56.469 -68.450 -68.750 -73.383
Ligands - SAM SAM SAM
Gene SLC35A5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.005 10.005 11.007
Length SE - 0. 1. 0.
Lev Distance - 55. 54. 55.
UBS 11. 13. 13. 12.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 4. 4. 4.
H 4. 3. 3. 3.
BL 5. 5. 5. 3.
BR 4. 4. 4. 4.
UN 0.203 0.133 0.132 0.120

Sequences

Field Description
UTR seq + 25 acagcgcgcgaagacggggugcgcgauccucgcaccccaggcagcccgcgacggaccggacccagcugucacccagccgcgagggagggcagcggggccgaagggagaccugagguaauuaaaaaacaguggaATGGAAAAACAGTGCTGTAGTCATC
UTR dot + 25 …(((.((……((((((((.(…).))))))))…..)).)))…….(((.(((.((((((.(((……..)))..)))))).)))))).(((….)))…………..((((((…((……)).))))))…….
RS 1 seq CGCUCAUCCAGAGGGGCAGAGGGACACGGCCCGUUGAAGCCCCGGCAACCCUCCAGUCGGUUCUCGCGAUCGCGCAUCCAGCGACGUCAGCGAGGUCCCCGGCUAGGGAAGGUGCCAAUUCCGUCUCAUGGCGAAGUGCGCCAUGGGGAAGAUGAGGA
RS 1 dot …………(((((((.(((……))).))…)))))(((.(((.(((((((((.((((((((.(((((…..))).)))).))))))…))))))..))).))))))…((..((((((((((…..))))))))))..))……
RS 2 seq CGCUCAUCCAGAGGGGCAGAGGGACACGGCCCGUUGAAGCCCCGGCAACCCUCCAGUCGGUUCUCGCGAUCGCGCACAUCAGCGACGUCAGCGAGGUCCCCGGCUAGGGAAGGUGCCAAUUCCGUCUCAUGGCGAAGUGCGCCAUGGGGAAGAUGAGGA
RS 2 dot …………(((((((.(((……))).))…)))))(((.(((.(((((((((.((((((((.(((((……))).)))).))))))…))))))..))).))))))…((..((((((((((…..))))))))))..))……
RS 3 seq CGCUCAUCCAGAGGGGCAGAGGGACACGGCCCGUUGAAGCCCCGGCAACCCUCCAGCCGGUCUCCGCCGCACGACAGCACAGUGCGCGCGCGAGGCUCCCGGCUAGGGAAGGUGCCAAAUCCGUCUCACGGCGAAAUGCGUCGUGAGGAAGAUGAGGA
RS 3 dot …………(((((((.(((……))).))…)))))(((.(((.(((((((((((((((((((((………))))).))).))))…))))))..))).))))))..(((..((((((((((…..))))))))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table