Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100014 Similarity: 0.990 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA100014
Gene: SLC37A2
MFE: -14.808
ENS: 0.714
Length: 57.
Predicted Ligands:
unknown - 16/20
glutamine - 2/20
fluoride - 1/20
 RS: URS0000C462F6_1629717
MFE: -16.930
Ligand: fluoride
Species: Peptococcaceae bacterium BRH_c4b Fluoride riboswitch
 RS: URS0000E5FA79_745310
MFE: -23.849
Ligand: unknown
Species: Sphingomonas sp. MM-1 nhaA-I RNA
 RS: URS0000E6002D_1660091
MFE: -23.636
Ligand: unknown
Species: Bordetella sp. SCN 67-23 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100014 URS0000C462F6_1629717 URS0000E5FA79_745310 URS0000E6002D_1660091
Length 57. 57. 57. 57.
Similarity - 0.990 0.990 0.988
Ensemble Norm 0.714 - - -
MFE -14.808 -16.930 -23.849 -23.636
Ligands - fluoride unknown unknown
Gene SLC37A2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 0. 6.025
Length SE - 0. 0. 0.
Lev Distance - 13. 14. 14.
UBS 5. 5. 5. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 1. 1. 0.
H 2. 2. 2. 2.
BL 1. 0. 1. 1.
BR 2. 1. 2. 1.
UN 0.053 0.105 0.070 0.211

Sequences

Field Description
UTR seq + 25 gucgacucagccuuagguaccggucaggcaaaATGCGGTCCTCCCTGGCTCCGGGAG
UTR dot + 25 …((((((((((.(……..).))))….)).))))(((((…….)))))
RS 1 seq AAUACAAGCGGCGAUGGAGCUCGCCUAAUGCGUUGCGCUGAUGGCUUCUGCCGGGCU
RS 1 dot ….((((((((((……)))))….)).))).(((..((((….))))))).
RS 2 seq GGGUGUUCGCCCCCGAUAAGGGACGGGCAGGACUUCGUGCUGGUCGGGCCGCCAGCA
RS 2 dot .((.((((((((((……))..)))).)))).))..((((((……)))))).
RS 3 seq GGGUGCUGCCGCUGUACAUGCGGGAGCAGGUUCUGGGCAUCGGUCGGGCCGCCGGUG
RS 3 dot …((((.((((…….)))).))))………(((((((……)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table