Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100204 Similarity: 0.949 Similarity: 0.946 Similarity: 0.946
UTR: 5HSAA100204
Gene: SLC39A10
MFE: -51.257
ENS: 0.987
Length: 190.
Predicted Ligands:
cobalamin - 12/20
FMN - 4/20
Mg2+ - 2/20
 RS: URS0000C03F9B_857265
MFE: -75.862
Ligand: FMN
Species: Neisseriaceae bacterium IGB-41 FMN riboswitch (RFN element)
 RS: URS0000D4EE3A_1314868
MFE: -49.301
Ligand: FMN
Species: Pseudoalteromonas carrageenovora IAM 12662 FMN
 RS: URS000232EA7D_1529
MFE: -35.819
Ligand: cobalamin
Species: Clostridium cadaveris Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100204 URS0000C03F9B_857265 URS0000D4EE3A_1314868 URS000232EA7D_1529
Length 190. 192. 189. 191.
Similarity - 0.949 0.946 0.946
Ensemble Norm 0.987 - - -
MFE -51.257 -75.862 -49.301 -35.819
Ligands - FMN FMN cobalamin
Gene SLC39A10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 4.010 10.011
Length SE - 4. 1. 1.
Lev Distance - 61. 69. 66.
UBS 12. 13. 12. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 1.
ILR 2. 3. 2. 3.
H 6. 7. 5. 6.
BL 2. 2. 3. 2.
BR 3. 3. 4. 1.
UN 0.089 0.146 0.190 0.194

Sequences

Field Description
UTR seq + 25 gaguggaccuuguacgccgcaagcguagcagggugucagacgcgccgguuucugcgacgcaguuagcgcagucugcuuuggugaauacacgauuuggugcagccgggguuugguaccgagcggagaggagaugcacacggcacucgagugugaggaaaaauagaaATGAAGGTACATATGCACACAAAAT
UTR dot + 25 ……(((((((((((…..))))).))))))..(((((((((……((((…))))…)))).)))))(((((((…..(((……)))..)))))))(((.((…..)).)))..(((.(((…..))))))..(((((……………………….)))))…..
RS 1 seq GUACGUCUUCAGGGCGGGGUGGAAUUCCCCACCGGCGGUAGGGUUGCGCUAUCUGGCAACCAAGCCCGCGAGCGCCUGGCGUUACGGAUAUUGAUAUCCCCACGCCAGGGUCAGCAGAUCCGGUGACACCGAUGCGCAAUGCAACGGUUAUUCCGGAGCCGACGGUUAGAGUCCGGAUGAAAGAAGAUCAGU
RS 1 dot …(((((…))))).(((((……))))).(((((..((((((……..))))))..))).))…..((((((((…(((((….)))))..))))))))((((.(……).))))((((.(((…..))).))))…((((((..(……..)..))))))……………
RS 2 seq GUAAAUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAUGUUUUACUCAAUACUUUUUUGAUUAAAACGAGCCCGCGAGCGCUUUAUUUAAUUUAUUUUUACAAUAUUGAAAAAGUUAAAUGAAGGUCAAGCAGAUCUGGUGAGAUGCCAGAGCCGACGGUUAAAGUCCGGAUGAAAGAGAAUAUAG
RS 2 dot …………((.((((…….)))).))…(((.(((((((.((((…….)))).))))))).))).((..(..((((((((((((..((((((……))))))))))))))))))..)..))…((((((…..)))))).(((((…….))).))…………….
RS 3 seq UGAAUAAGACAAGCUUAAGGUUACAUUUUUAAGCAAUGUAUUAAAAGGGAAUAUGGUUAAAAUCCAUAACAGCCCCCGCUACUGUAAGAAUGACGAAAACUUAUAUUUUAGUCACUGAGAUAUAUCUCGGGAAGACUUAAGUUAGUAGGAUGAUUUUGAGUCAGGAGACCUGCCCUAUGCUUUUAAAAGAA
RS 3 dot ……..(((.((((((((……))))))))..)))…….(((..(((((…….)))))….)))..((((.((((((………..))))))…))))..((((((….))))))…(((((((((((……)))))).)))))(((……..)))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table