Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100297 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA100297
Gene: SLC3A1
MFE: -11.080
ENS: 0.
Length: 94.
Predicted Ligands:
TPP - 18/20
fluoride - 1/20
glycine - 1/20
RS: URS0000D7FE57_104268
MFE: -14.307
Ligand: TPP
Species: Tenacibaculum mesophilum TPP riboswitch (THI element)
RS: URS0000DB0DE0_1802180
MFE: -30.797
Ligand: fluoride
Species: Spirochaetes bacterium GWC1_61_12 Fluoride riboswitch
RS: URS0000AB2F3A_643867
MFE: -16.968
Ligand: TPP
Species: Marivirga tractuosa DSM 4126 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100297 URS0000D7FE57_104268 URS0000DB0DE0_1802180 URS0000AB2F3A_643867
Length 94. 95. 94. 94.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0. - - -
MFE -11.080 -14.307 -30.797 -16.968
Ligands - TPP fluoride TPP
Gene SLC3A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 2.041 5.
Length SE - 1. 0. 0.
Lev Distance - 24. 26. 26.
UBS 5. 5. 6. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 2. 1. 2.
H 3. 2. 4. 2.
BL 1. 2. 1. 0.
BR 1. 1. 1. 0.
UN 0.404 0.368 0.202 0.394

Sequences

Field Description
UTR seq + 25 uuaaauuccuccuagaagcaaagcaccugagagaugagauccaaguaaauaagacccaaaucccgguucATGGCTGAAGATAAAAGCAAGAGAG
UTR dot + 25 ……..(((.(((..((…))..))).)))……………….((((……..))))….(((………)))…….
RS 1 seq AGUAAACUUUAGGAGUAGCUAGUUCGCUAGUUUGAGAAAGAUCCUUUGAACCUGAUAUGGUUAACACCAGCGUAGGGAAAAGUUAUAAAAUCUUA
RS 1 dot ……((((.(((.((((……)))).)))…))))……….((((…((((….))))…))))……………….
RS 2 seq UCGGCCCACGGCGAUGGAGUUCGCCGAGCCUUCCCGAUUCCGGGUGAACUAAACUGCCUACCCUCCGGUACUGGCUGAUGACUCCUGCCAACAU
RS 2 dot ..(((…((((((……)))))).)))..((((….))))……….((((……..)))).((((.((….))..))))….
RS 3 seq AUAUUUUAAAUGGGGUGCCAACUGAAGGGCUGAGAUUAUACCCAAAUAACCUGAUCUAGGUAAUGCUAGCGUAGGAAUUGUGAAAACCAAUCGA
RS 3 dot …………(((((((……..)))………))))……((((..((((……))))..))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table