Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100489 Similarity: 0.938 Similarity: 0.935 Similarity: 0.935
UTR: 5HSAA100489
Gene: SLC46A1
MFE: -71.552
ENS: 0.862
Length: 211.
Predicted Ligands:
cobalamin - 17/20
unknown - 1/20
glucosamine - 1/20
 RS: URS000231F9F5_35806
MFE: -93.938
Ligand: cobalamin
Species: Rhodovulum sulfidophilum Cobalamin riboswitch
 RS: URS0002322CF6_1305675
MFE: -55.977
Ligand: cobalamin
Species: Bacillus solimangrovi Cobalamin riboswitch
 RS: URS00023301FB_88274
MFE: -57.632
Ligand: cobalamin
Species: delta proteobacterium NaphS2 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100489 URS000231F9F5_35806 URS0002322CF6_1305675 URS00023301FB_88274
Length 211. 212. 210. 213.
Similarity - 0.938 0.935 0.935
Ensemble Norm 0.862 - - -
MFE -71.552 -93.938 -55.977 -57.632
Ligands - cobalamin cobalamin cobalamin
Gene SLC46A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 18.017 9.001
Length SE - 1. 1. 4.
Lev Distance - 81. 76. 76.
UBS 13. 14. 10. 14.
BS 0. 0. 0. 0.
ILL 5. 4. 3. 4.
ILR 3. 3. 1. 5.
H 6. 6. 6. 5.
BL 2. 3. 1. 3.
BR 2. 2. 2. 1.
UN 0.109 0.075 0.238 0.080

Sequences

Field Description
UTR seq + 25 gcgaugguuaauauuggcuagccuguagaguuaucgggagaccaacgcacaaaaaggguuuaauaccgugcccagcacauaggcccgcucaccacgcaguaucuguggcaccgcuucagcgccgaccucggcuacaauggcacccgccaaagggggggcugcagcaaccgcagcgcggaccccaccATGGAGGGGAGCGCGAGCCCCCCGG
UTR dot + 25 (((.(((((….((((.((((…….))))))))..))))).)))…….(((((((…..((((…)))).)))))))((…(((((…….)))))….))……((((….))))…..((((….))))…((((((((………….((((..((((……..))))..))))))))))))..
RS 1 seq UCUACCAUUGCGACGGAUGGUGCGCAUGCUCUCGCCUGCAGGGAGCAUGACUGAAAAGGGAAUGCGGUGCGGGGGAUCCCCCCAAGGCCGCGGCUGCCCCCGCAACUGUAAGCGGCGAGCGGUUCUGGAAGAUGCCACUGGGCGAUGCCCGGGAAGGCCCGGAGCCGCGGCGACCCGCAAGCCAGGAGACCUGCCAUCCGCUUGGUGUUGAA
RS 1 dot .((((((((……))))))).)(((((((((…….)))))))))……..(((..((((((..(((((…)))))…))))))….)))((((……..))))…((((((((((…..(((.((((((…))))))…)))))))))))))..((((.(.(((((..(((………))))))))).))))..
RS 2 seq AGGAAUUCGUAGCACAUAGGUGUCGGAUGAAUAGUUAACUAGUUAACUAUUCAUCCGACUGAAAAGGGAAUCUGGUGAAAUUCCAGAACUGUCCCCGCAACUGUAAUUGUGGACGAAAUGAGAUCACCACUGUGCCUAUAAUGAUGCAUGGGAAGGCUCAAAGUAGAAAGAAGCAUAAGUCAGUAGACCUGCCUAAUGAGCUCGUAGUUU
RS 2 dot …………………(((((((((((((((((….)))))))))))))))))…….(((.(((((…….)))))….)))((((((……))))))…………(((….)))(((((……..)))))..((((((…(((……(((…(((….))).)))))).))))))……..
RS 3 seq UUCGCGACGGAAUAUUCGGGUGCUCCUAAGGAGCUUAAAAGGGAACCUCGUGGGAAUCGAGGACGGACCCGCCGCUGUAACCCUUGCUCUUCACCGCAUUUGAUGGGAAGAGAACUUUCUUGGCCUCUGUUUGCCACUGUCUUCAUAACCGGGAUGGGAAGGCCGCCAAGAUGGAUGGGAAGCCAGAAGACCUGCCCAUGAAUGGAGAUUUAA
RS 3 dot (((((((.((………..(((((…)))))………..)))))))))…(((((((((……..))))…)))))((((((.((((….).)))))))))……..((((……..))))..((((((((….(((.((((..(((..((……….))..)))……)))))))….))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table