Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100651 Similarity: 0.989 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA100651
Gene: SLC6A3
MFE: -9.915
ENS: 0.976
Length: 58.
Predicted Ligands:
fluoride - 9/20
glutamine - 6/20
unknown - 5/20
 RS: URS0000BF456D_497965
MFE: -11.973
Ligand: glutamine
Species: Cyanothece sp. PCC 7822 Glutamine riboswitch
 RS: URS0000C462F6_1629717
MFE: -16.930
Ligand: fluoride
Species: Peptococcaceae bacterium BRH_c4b Fluoride riboswitch
 RS: URS0000BFD21A_65393
MFE: -12.651
Ligand: glutamine
Species: Cyanothece sp. PCC 7424 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100651 URS0000BF456D_497965 URS0000C462F6_1629717 URS0000BFD21A_65393
Length 58. 58. 57. 59.
Similarity - 0.989 0.985 0.985
Ensemble Norm 0.976 - - -
MFE -9.915 -11.973 -16.930 -12.651
Ligands - glutamine fluoride glutamine
Gene SLC6A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 5.019 2.007
Length SE - 0. 1. 1.
Lev Distance - 13. 17. 18.
UBS 4. 3. 5. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 1. 1. 0.
H 2. 2. 2. 2.
BL 1. 1. 0. 1.
BR 2. 0. 1. 1.
UN 0.241 0.293 0.105 0.322

Sequences

Field Description
UTR seq + 25 agaugaggccgugcuguuccgaggguuauuaggATGAGTAAGAGCAAATGCTCCGTGG
UTR dot + 25 …….(((((.(((………….))).))).))..((((….))))…..
RS 1 seq AUCGUUCAUCUCUUUAUACCAGAGACGGAAGUAGGGAAAGUUCCCGAAGGAACGCGCC
RS 1 dot ……….(((((((.((……))..)))))))..(((((….)))))…..
RS 2 seq AAUACAAGCGGCGAUGGAGCUCGCCUAAUGCGUUGCGCUGAUGGCUUCUGCCGGGCU
RS 2 dot ….((((((((((……)))))….)).))).(((..((((….))))))).
RS 3 seq AUCGUUCAUCUCUAUUCAAGCAGAGACGGAAGUAGGGAAAGUUCCCGAAGGAACGCGCC
RS 3 dot ….(((.(((((……..))))).)))……….(((((….)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table