Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100661 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA100661
Gene: SLC6A6
MFE: -31.
ENS: 0.815
Length: 107.
Predicted Ligands:
TPP - 20/20 - 20/20


 RS: URS0000D84EA8_1121420
MFE: -27.725
Ligand: TPP
Species: Desulfosporosinus lacus DSM 15449 TPP riboswitch (THI element)
 RS: URS0000C5FAB1_1121335
MFE: -29.659
Ligand: TPP
Species: [Clostridium] stercorarium subsp. stercorarium DSM 8532 TPP riboswitch (THI element)
 RS: URS0000AB4048_591158
MFE: -41.525
Ligand: TPP
Species: Streptomyces sp. AA4 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100661 URS0000D84EA8_1121420 URS0000C5FAB1_1121335 URS0000AB4048_591158
Length 107. 108. 106. 108.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.815 - - -
MFE -31. -27.725 -29.659 -41.525
Ligands - TPP TPP TPP
Gene SLC6A6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.014 0.020 8.
Length SE - 1. 1. 1.
Lev Distance - 26. 28. 26.
UBS 5. 5. 5. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 2. 1. 2.
H 3. 3. 3. 4.
BL 0. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.140 0.259 0.283 0.130

Sequences

Field Description
UTR seq + 25 acuuccuggcugugcaaccucggucaagucgcuuauugauucugagccguaguuccucaucuccauuugggaaagcaaggagATGGGTGATGCTGAGAGCTGCCTGC
UTR dot + 25 ……((((((……..))))))….(((((…….))))).((((((((((((((((..(((……))))))))))))………)))))))….
RS 1 seq UUAUUAAACAUCGGGAGCUUGAUGAACAGGCUGAGAGUACGACUAAUGUCGUAGACCGAUUGAACCUGUUGGGUAAUGCCAGCGCAGGGAAUGUUAUUUUAGUCAAUA
RS 1 dot ……………((((((…..))))))…..((((((….))))))….(((((((((((((((……)))..)))))………)))))))….
RS 2 seq CAUUAAAGCUGGGGGUGCCUUCAAAGGCUGAGAAAGAGGAUUAUCCUCUUAACCCUUUGAACCUGAUGCGGUUAGUACCGCCGGAGGGAAGCUGACUUUUAUAAUU
RS 2 dot ……(((((((….)))…..))))….(((((((…)))))))..(((((((……..(((((….))))))))))))………………
RS 3 seq GGGAGUCCGCACGGGAGCCCGAGGCAAACGGGCUGAGAGGGAGCUGCCGCUCCGACCGUGGAACCUGAUCCGGGUCAUGCCGGCGCAGGGAGCGUGAUUCCACUGUGA
RS 3 dot ……((…..))((((((…….))))))…..(((((….))))).((.((((((((((..((((……))))..))))……..)))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table