Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100788 Similarity: 0.978 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA100788
Gene: SLC9A6
MFE: -41.325
ENS: 0.
Length: 101.
Predicted Ligands:
TPP - 12/20
purine - 3/20
glycine - 3/20
RS: URS0000D888A2_1214604
MFE: -22.031
Ligand: purine
Species: Tumebacillus algifaecis Purine riboswitch
RS: URS0000AB55F9_350058
MFE: -28.076
Ligand: glycine
Species: Mycobacterium vanbaalenii PYR-1 Glycine riboswitch
RS: URS0000D7B715_1121391
MFE: -37.650
Ligand: TPP
Species: Desulfacinum infernum DSM 9756 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100788 URS0000D888A2_1214604 URS0000AB55F9_350058 URS0000D7B715_1121391
Length 101. 102. 99. 103.
Similarity - 0.978 0.977 0.976
Ensemble Norm 0. - - -
MFE -41.325 -22.031 -28.076 -37.650
Ligands - purine glycine TPP
Gene SLC9A6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 4.002 4.
Length SE - 1. 4. 4.
Lev Distance - 27. 25. 26.
UBS 9. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 2. 3. 3. 3.
H 2. 2. 2. 2.
BL 5. 5. 4. 5.
BR 4. 4. 3. 3.
UN 0.040 0.069 0.081 0.049

Sequences

Field Description
UTR seq + 25 uuucccgugagcccucggggagugguccgaccgcgggcggccgccggugagguaggggcgggaggcggggggagacATGGACGAGGAGATCGTGTCCGAGA
UTR dot + 25 ((((((((..((((((((.(.((.(((((….))))).))).)))……..)))))…..))))))))…(.((((((.(…..).)))))).).
RS 1 seq CCAACCAAUUGAAUAAGCUCUCGUAUAAUCGUGGGGAUAUGGCCCACAAGUUUCUACCAGGCUACCGUAAAUGGCUUGACUACGAGUGAAGCACACCUCGCA
RS 1 dot .((((((.(((….(((.((.(((.(((.(((((…….)))))..)))..))).)))))….))).))).)))….((((((…..))).)))..
RS 2 seq UCGCCCUGUGCGGGAGAGUUCCGUUGCCGCCAGCCACGGACGCCGAAGGAGCAAUACCUCUCCGUCAACCUCUCAGGCACCCAGGACCGCGCCAGGCCC
RS 2 dot ..(.((((((..((((((((((.(((.((((……)).)).))).)))))……)))))..))……)))))…..((.((……)))).
RS 3 seq GCGAUCGCCAGGGGGCGUCCUUUCCCCGUGGAAAGGGCUGAGAAGUCACCCCUCGAACCUGAUCCAGGUCAUGCUGGCGGAGGGAUUGGCGAGCGGAUCGAGA
RS 3 dot (.((((((.((((((((((((((((….)))))))))……))..))))).)….)))))).((((.((((.((.((….)).)).))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table