Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100820 Similarity: 0.968 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA100820
Gene: SLCO1B1
MFE: -20.892
ENS: 0.899
Length: 129.
Predicted Ligands:
cobalamin - 8/20
TPP - 6/20
FMN - 3/20
 RS: URS0000AB6C21_767817
MFE: -35.367
Ligand: FMN
Species: Desulfotomaculum gibsoniae DSM 7213 FMN riboswitch (RFN element)
 RS: URS0000D7CE9E_1906741
MFE: -51.137
Ligand: glycine
Species: Jeongeupia sp. USM3 Glycine riboswitch
 RS: URS000231DD58_317936
MFE: -29.214
Ligand: cobalamin
Species: Nostoc sp. PCC 7107 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100820 URS0000AB6C21_767817 URS0000D7CE9E_1906741 URS000231DD58_317936
Length 129. 128. 130. 129.
Similarity - 0.968 0.965 0.965
Ensemble Norm 0.899 - - -
MFE -20.892 -35.367 -51.137 -29.214
Ligands - FMN glycine cobalamin
Gene SLCO1B1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.007 11. 7.003
Length SE - 1. 1. 0.
Lev Distance - 37. 42. 45.
UBS 8. 9. 9. 10.
BS 0. 1. 0. 0.
ILL 4. 2. 3. 4.
ILR 3. 4. 2. 2.
H 3. 4. 3. 3.
BL 0. 2. 2. 1.
BR 1. 1. 3. 2.
UN 0.178 0.094 0.185 0.124

Sequences

Field Description
UTR seq + 25 aaaggguggacuuguugcaguugcuguaggauucuaaauccaggugauuguuucaaacugagcaucaacaacaaaaacauuuguaugauaucuauauuucaaucATGGACCAAAATCAACATTTGAATA
UTR dot + 25 ….((((..((((..(((((((((…(((((…))))).)))))))))..)))…)..))))….(((((….)))))………….(((((..(((…………))))))))..
RS 1 seq AUUAACCUUCAGGGACUGGUGAAAUUCCGUACCGGCGGUAAGGUCAUAUUCUAAGCCCGCGAGCCCUUAAGGGCUGAUCCGGUGUAAUUCCGGAGCCGACAGUAAAGUCUGGAUGGGAGAAGGUUGUU
RS 1 dot ..((((((((.(((..((((((..((((((….)))).))..)))….)))..)))…(((((….)))))..(((((…….))))).(((.(((……)))..)))..))))))))..
RS 2 seq GGACGAGCCUCUGGAGAGCCCCGGCGUGCAUCACCGUUUUCAGGACGGACUGCACCGGCCGGGCACCGAAGGCGAAAGGCGUUCCGUCAGGAACGCUGAAACGCUCAGGUAAAAGGACAGAGGAAGGACG
RS 2 dot ……((((.(((…(.(((((((((((…((((((…))))))..)))))..))))))).))).))))….((((((((….))))))))……(((..((……)).)))……..
RS 3 seq UUCCGCAGACAGUCUCAUGGUAAAUUACUAAAGCUUAGAGUUGGGAAACUCCGGUGAAAUUCCGGGACUGUGCCGCAGCUGUGAAGGGAAAUCCCAAGUCAGAAUGCCAACUCCGGGGUGUCUAAAAGA
RS 3 dot …(((((((((((((..((….(((((…(….(((((….)))))))))))….))))))))))…….)))))..(((….)))…..(((((.((……)).)).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table