Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100821 Similarity: 0.959 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA100821
Gene: SLCO1B3
MFE: -23.861
ENS: 0.906
Length: 151.
Predicted Ligands:
FMN - 8/20
glucosamine - 6/20
cobalamin - 4/20
 RS: URS0000BEABF2_1590
MFE: -37.424
Ligand: glucosamine-6-phosphate
Species: Lactobacillus plantarum glmS
 RS: URS0000C10935_1400520
MFE: -38.174
Ligand: glucosamine
Species: Lactobacillus fabifermentans T30PCM01 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS000061E6E9_220668
MFE: -39.324
Ligand: glucosamine
Species: Lactobacillus plantarum WCFS1 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100821 URS0000BEABF2_1590 URS0000C10935_1400520 URS000061E6E9_220668
Length 151. 152. 152. 152.
Similarity - 0.959 0.959 0.959
Ensemble Norm 0.906 - - -
MFE -23.861 -37.424 -38.174 -39.324
Ligands - glucosamine-6-phosphate glucosamine glucosamine
Gene SLCO1B3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 4.003 4.003
Length SE - 1. 1. 1.
Lev Distance - 53. 53. 53.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 4. 3. 3. 3.
H 5. 4. 4. 4.
BL 1. 1. 1. 1.
BR 0. 0. 0. 0.
UN 0.172 0.118 0.118 0.118

Sequences

Field Description
UTR seq + 25 gagacuuuaacaucagaaaaaggauggacuuguugcaguugcuguagcauucaaagucaaggugaucauuucaaaccaagcaucagcaacaauuaaaaauauucacuugguaucuguaguuuaauaATGGACCAACATCAACATTTGAATA
UTR dot + 25 ……….((((……..))))((((((((((((…))))))))…..))))..(((………..)))..((….))…………((((((..((…..(((.(((((….)))))..)))….))..))))))
RS 1 seq UAAAGCGGAAUAGCGCCAGGACUUUAGAAUCUAAAGUUGACGAGGAUGACGUUUAUCGAUAAUCGACGGGUGACGUCAGGGACUGCACUCUACAGGUCAAUUACAAAAACCGACUGUGAGGUUGGUGACAGAUAUAUUGACUACGCAGCUAG
RS 1 dot ….(((……)))…((((((((…))))))))……..(((((((..(((……..)))..))))))).((.((((……..(((((((…….(((((((….)))))))………)))))))..))))))..
RS 2 seq UAAAGCGGAAUAGCGCCAGGACUUUAGAAUCUAAAGUUGACGAGGAUGACGUUUAUCGACAAUCGACGGGUGACGUCAGGGACUGCACUCUACAGGUCAAUUACAAAAACUAGUCGUGAGAUUAGUGACAGAUAUAUUGACCACGCAGCUAG
RS 2 dot ….(((……)))…((((((((…))))))))……..(((((((..(((……..)))..))))))).((.((((……..(((((((…….(((((((….)))))))………)))))))..))))))..
RS 3 seq UAAAGCGGAAUAGCGCCAGGACUUUAGAAUCUAAAGUUGACGAGGAUGACGUUUAUCGAUAAUCGACGGGUGACGUCAGGGACUGCACUCUACAGGUCAAUUACAAAAACCGACUGUGAGGUUGGUGACAGAUAUAUUGACCACGCAGCUAG
RS 3 dot ….(((……)))…((((((((…))))))))……..(((((((..(((……..)))..))))))).((.((((……..(((((((…….(((((((….)))))))………)))))))..))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table