Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100920 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA100920
Gene: SLITRK3
MFE: -21.801
ENS: 0.875
Length: 122.
Predicted Ligands:
TPP - 10/20
glycine - 4/20
cobalamin - 2/20
 RS: URS0000ABA282_479432
MFE: -47.092
Ligand: cobalamin
Species: Streptosporangium roseum DSM 43021 Cobalamin riboswitch
 RS: URS0000C862C2_1842533
MFE: -49.685
Ligand: glycine
Species: Acidovorax sp. RAC01 Glycine riboswitch
 RS: URS0000C3299E_553198
MFE: -43.066
Ligand: FMN
Species: Propionibacterium acidifaciens F0233 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100920 URS0000ABA282_479432 URS0000C862C2_1842533 URS0000C3299E_553198
Length 122. 122. 121. 122.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.875 - - -
MFE -21.801 -47.092 -49.685 -43.066
Ligands - cobalamin glycine FMN
Gene SLITRK3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 15.008 4.010
Length SE - 0. 1. 0.
Lev Distance - 38. 34. 40.
UBS 9. 8. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 5. 3. 3.
ILR 4. 4. 4. 5.
H 2. 2. 1. 1.
BL 1. 1. 4. 1.
BR 1. 1. 3. 2.
UN 0.131 0.156 0.041 0.033

Sequences

Field Description
UTR seq + 25 acaaaucaauccacggguacagaaugcugacuucccgacacucaauuucacagggugucucuugaagagcugccaguuuuguaaucaaccacgaacgATGAAACCTTCCATAGCTGAGATGC
UTR dot + 25 …..((.(((..(((((((((((((((..((((..(((((((………)))))))….)))))))…..)))))))…..))).))…)))))………..((……))
RS 1 seq AACGAGGAAACCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUGAUCGGCGAGCGGAUCCCGGGCAGGCCACCGCGGGUGCGGGAAGGCCGGGACGAGCAUCGACCCGAGAGCCAGGAGACUC
RS 1 dot ………..((((((…((((((.(..((((((..(((((…(((..((………))..)))..)))))..)))))).)))))))….))))))..((……..))……
RS 2 seq CAAAAGCCGUCUGGAGAGCCGCUGCAACCCACUACCGGGCCUGCAGCGCACCGAAGGAGCAAACCGCAGCCCGGGUGGGAUGGCGGUGAAUCUCUCAGGUACCAAGGACAGGGGGAGCGGC
RS 2 dot …..((((((((((((..((((((..(((((..(((((.((((.(.((.((…)).))…).))))))))))))))…))))))..)))).)))………………)))))
RS 3 seq CAACGUGCCCGGGGUCGGUGAAAACCCGAACCGGCGGUGACAGCCCGCGAACCAGCCCAGAGCUGGCCGAACCGGUGGGAUUCCGGUGCCGACGGUGACAGUCCGGAUGGGAGAGCAUGUGC
RS 3 dot ..((((((((((((((((((((..(((..(((((((((..(((((.((……))…).))))))))..)))))))).)))….))))))……..)))))……..))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table