Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA100931 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA100931
Gene: SLITRK5
MFE: -24.796
ENS: 0.650
Length: 90.
Predicted Ligands:
guanidine - 10/20
zmp-ztp - 8/20
cobalamin - 2/20
 RS: URS0000C15C50_485913
MFE: -25.252
Ligand: zmp-ztp
Species: Ktedonobacter racemifer DSM 44963 ZMP/ZTP riboswitch
 RS: URS0000D8B336_362257
MFE: -35.882
Ligand: zmp-ztp
Species: Streptomyces vietnamensis ZMP/ZTP riboswitch
 RS: URS0002331E7E_1736379
MFE: -37.524
Ligand: cobalamin
Species: Marmoricola sp. Leaf446 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA100931 URS0000C15C50_485913 URS0000D8B336_362257 URS0002331E7E_1736379
Length 90. 89. 91. 89.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.650 - - -
MFE -24.796 -25.252 -35.882 -37.524
Ligands - zmp-ztp zmp-ztp cobalamin
Gene SLITRK5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 5.001 4.
Length SE - 1. 1. 1.
Lev Distance - 22. 25. 26.
UBS 7. 6. 8. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 1. 1.
H 3. 3. 3. 3.
BL 4. 2. 3. 3.
BR 4. 2. 3. 3.
UN 0.133 0.101 0.110 0.135

Sequences

Field Description
UTR seq + 25 gaacuguuaacugaagaggcucugaaagaaagaagggggggugggggcuggguauaggagguaaaATGCACACTTGCTGCCCCCCAGTAA
UTR dot + 25 …((.((…..)).))..(((…….)))..(((((((((.((.((.((((……….)))).)).)).)))))))))…..
RS 1 seq CUGUUCCCUGGUAACUGGCGAUAAGAGUGGAAGAACCACAAGGGAGCCUGGGAAUAAGCAGUAAACAGUCGCUCGCCUGGGCUGCUUCA
RS 1 dot .((((.((……..)).))))…((((…..))))..((.((((((((….(((………..)))..)))))))).))…
RS 2 seq AACACGCACGGCGACUGGCGUACGGGGAAGCGACCCCGGGGAAGCCGCGCGCGCUCCACCACACGAGGUGCCGCUCGCCUGGGCAUCACGG
RS 2 dot …((((.(((…))))))).(((((……)))))..((.((((((.(((…((((……)))).))).)))…))).))….
RS 3 seq GGAAGCCGGUGGGAAUCCGGCACAGUCGCGCUACUGUGACACCUCCUCCAGACGGUCAUCACGAUCGUCGGGCGGCGGUGGAGUCAGAC
RS 3 dot (((..((….))..)))..((((((……)))))).((((.((.((.(((((((…..))))))).)).)).))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table