Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101349 Similarity: 0.966 Similarity: 0.961 Similarity: 0.959
UTR: 5HSAA101349
Gene: SMC4
MFE: -39.325
ENS: 0.905
Length: 138.
Predicted Ligands:
cobalamin - 6/20
FMN - 5/20
TPP - 4/20
RS: URS0000D961F6_1519565
MFE: -28.669
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
RS: URS00023152FE_1265868
MFE: -42.613
Ligand: cobalamin
Species: Streptomyces rimosus subsp. rimosus ATCC 10970 Cobalamin riboswitch
RS: URS0000C02A4D_1121915
MFE: -45.727
Ligand: cobalamin
Species: Geoalkalibacter ferrihydriticus DSM 17813 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101349 URS0000D961F6_1519565 URS00023152FE_1265868 URS0000C02A4D_1121915
Length 138. 139. 137. 137.
Similarity - 0.966 0.961 0.959
Ensemble Norm 0.905 - - -
MFE -39.325 -28.669 -42.613 -45.727
Ligands - TPP cobalamin cobalamin
Gene SMC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.009 4.009 7.001
Length SE - 1. 1. 1.
Lev Distance - 38. 50. 50.
UBS 11. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 1.
ILR 2. 4. 3. 1.
H 4. 4. 4. 6.
BL 5. 3. 5. 4.
BR 3. 2. 4. 2.
UN 0.138 0.043 0.044 0.161

Sequences

Field Description
UTR seq + 25 uaggcgccauuuucgagugaaggacccggagccgaaacaccgguaggagcggggagguggguacuacacaaccgucuccagccuuggucugaguggacuguccugcagcgaccATGCCCCGTAAAGGCACCCAGCCCT
UTR dot + 25 ..(((.((…(((…….)))…)).)))……(((…….)))((((((((………..)))))))).((((((((.((.((.(.((((…))))).)))).)))…..)))))……….
RS 1 seq CACUCUCGCUGCGGGAGCUUGAUGUGGGAAAUAAUAUGCUGAGAGUUUCAAAGUCUAUGGUUCUUGAAAAGACUUUGUAUCGACCGUUCGAACCUGCUCAUGGUAAUGCAUGCGAAAGGGAACGUGAGUUGUGCAAUGG
RS 1 dot (((((..(((…..)))..)).))).(((((..(……)..)))))(((((((………….)))))))(((.(((((((((…(((.(.((((……)))).)..))))))))…)))))))…..
RS 2 seq CAGCACAAGAUGUAUGCUCGUGCUCGCUGUCGUCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACGAAGUGCGGCAAUCCGCACCCGUGAGUCCGAAGACCUGCCCGCAGUACGCCCGCGCC
RS 2 dot .(((((.((…….)).)))))..((((….))))((((.(((((…….)))))….))))((…(((((((…(((.((((.((((.((……)).))..))..))))))).))))))).))…
RS 3 seq GGAAGAGGGGUGCAAAGCCCCCGCUGCCCCGCAGCCGUAAUGGGAACGAACACCCACCCACGCAUUGAUCGCAUGGGUACAGCCACUGGGAUUUCUCCUGGGAAGGCGGGUCAGUAGGUCGCCCUGAGCCGGAAUAC
RS 3 dot ……((((.((…))))))(((((…)))))……(((……..)))(((((.((…….)).)))))….((.((((((….))))))…))(((.((((..((…)))))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table