Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101353 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA101353
Gene: SMC4_0
MFE: -24.416
ENS: 0.990
Length: 89.
Predicted Ligands:
TPP - 16/20
glycine - 3/20
GMP - 1/20
 RS: URS0000C3FAE3_1144300
MFE: -19.974
Ligand: TPP
Species: Lactobacillus gastricus PS3 TPP riboswitch (THI element)
 RS: URS0000D6C6DB_12908
MFE: -40.458
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D93AA5_1986704
MFE: -19.434
Ligand: TPP
Species: Flavobacteriaceae bacterium TMED145 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101353 URS0000C3FAE3_1144300 URS0000D6C6DB_12908 URS0000D93AA5_1986704
Length 89. 89. 88. 90.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.990 - - -
MFE -24.416 -19.974 -40.458 -19.434
Ligands - TPP GMP TPP
Gene SMC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 1.010 4.003
Length SE - 0. 1. 1.
Lev Distance - 25. 26. 26.
UBS 6. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 0. 1. 1.
H 4. 3. 4. 3.
BL 1. 2. 1. 1.
BR 1. 3. 0. 0.
UN 0.191 0.202 0.091 0.244

Sequences

Field Description
UTR seq + 25 uuuuaggcgccauuuucgagugaaggacccggagccgaaacaccgguaggagcggggagcgaccATGCCCCGTAAAGGCACCCAGCCCT
UTR dot + 25 …..(((.((…(((…….)))…)).)))……((….)).((((((……….))))))…(((…..)))..
RS 1 seq AUUAGUUAUCUGGGGCGCUUUUUAGCUGAGAUGAACCCAUUGAACCUGCUCUGGUUAGGACCAGCGAAGGGAGAUAAACGAUUUUAUUC
RS 1 dot …..((((((..(((……..))).))))))……….(((.(.(((((….))))).).)))..((((((….)))))).
RS 2 seq GGGGCAGCGGGAAGCUCUUGCACGCGGUCCGCGCCCACGGCCGCUCAAGGCCGCGCCGAGCCCACUGGCGAGACCGACCCGCGUUGAU
RS 2 dot .((((.(((((..((……..))..))))))))).(((((……)))))(((((…….)))))….((((….))))..
RS 3 seq UUCUAAUAAUAGGGGUGCUUUGAAGGCUGAGAUUAUACCCAUUGAACCUGGAACAGGUAAUGCUGUUUAGGAAAUUGAUAAUUUCAAUGU
RS 3 dot …………((((((((……..)))….)))))……(((.((((((……)))))))))..(((((…..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table