Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101368 Similarity: 0.974 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA101368
Gene: SMC4_1
MFE: -28.195
ENS: 0.992
Length: 114.
Predicted Ligands:
TPP - 9/20
FMN - 2/20
zmp-ztp - 2/20
 RS: URS0000ABC348_340099
MFE: -31.948
Ligand: FMN
Species: Thermoanaerobacter pseudethanolicus ATCC 33223 FMN riboswitch (RFN element)
 RS: URS0000AB1FCA_862751
MFE: -49.864
Ligand: TPP
Species: Streptomyces sp. SirexAA-E TPP riboswitch (THI element)
 RS: URS0000ABAFC3_1262758
MFE: -28.176
Ligand: tetrahydrofolate
Species: Blautia sp. CAG:52 THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101368 URS0000ABC348_340099 URS0000AB1FCA_862751 URS0000ABAFC3_1262758
Length 114. 115. 114. 113.
Similarity - 0.974 0.971 0.971
Ensemble Norm 0.992 - - -
MFE -28.195 -31.948 -49.864 -28.176
Ligands - FMN TPP tetrahydrofolate
Gene SMC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.013 8.006 3.004
Length SE - 1. 0. 1.
Lev Distance - 33. 35. 37.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 2. 2. 3. 1.
H 3. 2. 3. 3.
BL 3. 3. 2. 3.
BR 3. 4. 1. 4.
UN 0.053 0.165 0.132 0.115

Sequences

Field Description
UTR seq + 25 guauuuuaggcgccauuuucgagugaaggacccggagccgaaacaccgguaggagcggggagguggguacuacacaaccgucuccagcaATGCCCCGTAAAGGCACCCAGCCCT
UTR dot + 25 ((.((((.(((.((…(((…….)))…)).))))))).))(((…..((..((((((((………..)))))))).))……)))….(((…..)))..
RS 1 seq UAAAACCUUCGGGGAUCGGUGAAAUUCCGUACCGGCGGUAUAGCCCGCGAGCCUUUUGGCAGACUCGGUGAAAUUCCGAGGCCGACAGUUAAAGUCUGGAUGGGAGAAGGAGAAA
RS 1 dot ….(((.((((….(((…….)))..)))).)))….(((((.((.((((((((…(((((…….))))))))))……))).)).).))))………..
RS 2 seq UAAGGCACUCGCGGGAGCCCGGACGGACCGGGCUGAGAGGGAGGCUGGCCGGCCUCCGACCGUCAACAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGGGGCUGGACGCCCAUG
RS 2 dot …(((.(((.(…(((((((…..)))))))….).)))))).((((((….((((((((……))))…))))..))))))……..((((…..))))…
RS 3 seq UGCAAAAUAGGUUUCCAUGCGUCAAGUGUUUUGUGGAUGGGGAGUUGCCACAGAAACGAAAAGUCGGUUCGCCUGCGGACCGGACUUACGAUAUGGUUACCGCACCCGUUGCA
RS 3 dot ………..(((((((.((.(((…..))))).)))))))((.((((……((..(((((((((((….))))))).)))).))…)))).)).(((…..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table