Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101371 Similarity: 0.985 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA101371
Gene: SMC4_2
MFE: -22.587
ENS: 1.
Length: 75.
Predicted Ligands:
cobalamin - 11/20
fluoride - 9/20

 RS: URS0000DA1224_1848292
MFE: -18.924
Ligand: fluoride
Species: Ensifer sp. LCM 4579 Fluoride riboswitch
 RS: URS0000BF4F82_545696
MFE: -14.886
Ligand: fluoride
Species: Holdemania filiformis DSM 12042 Fluoride riboswitch
 RS: URS0000DA83F5_887144
MFE: -16.923
Ligand: fluoride
Species: Rhizobium sp. CCNWSX0483 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101371 URS0000DA1224_1848292 URS0000BF4F82_545696 URS0000DA83F5_887144
Length 75. 76. 74. 77.
Similarity - 0.985 0.983 0.983
Ensemble Norm 1. - - -
MFE -22.587 -18.924 -14.886 -16.923
Ligands - fluoride fluoride fluoride
Gene SMC4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.009 2.001 5.032
Length SE - 1. 1. 4.
Lev Distance - 17. 21. 17.
UBS 5. 7. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 1. 0. 0.
H 4. 4. 4. 3.
BL 1. 2. 0. 0.
BR 1. 2. 1. 0.
UN 0.160 0.066 0.189 0.338

Sequences

Field Description
UTR seq + 25 auuuucgagugaaggacccggagccgaaacaccgguaggagcggggagcaATGCCCCGTAAAGGCACCCAGCCCT
UTR dot + 25 ..(((((.((…..)).)))))(((……)))…..((((((…….))))))…(((…..)))..
RS 1 seq UGGCACGUCGGCAAUGGAUUCUGCCAGGCAUCAAGCCGAACCGCUUCCCCACGAAGCUGAUGACUCCUGCUCAUGA
RS 1 dot (((((.(((…….)))..)))))(((…..)))…..(((((…..)))))(.(((((….).)))).)
RS 2 seq UAAAGGACAGGGAAUGAUUUCUCCCCUGGCAAUCCGCCUAAACCGCUGUUUCAGCUGAUGACUUCUAUGUGUUU
RS 2 dot …(((…(((((….))))).)))(((…..)))……((((…))))….(((……..))).
RS 3 seq AUCGGCAACGGUAAUGGAUUCUGCCGGGCAUUAAGCCGAACCGCUUCCCCGAUGAAGCUGAUGACUCCUACUCAACG
RS 3 dot ..(((((..((……..)))))))(((…..)))…..(((((……)))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table