Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101576 Similarity: 0.977 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA101576
Gene: SMR3A
MFE: -21.635
ENS: 0.907
Length: 106.
Predicted Ligands:
TPP - 7/20
SAM - 5/20
glycine - 4/20
RS: URS0000C350B2_1660094
MFE: -26.616
Ligand: glycine
Species: Clostridium sp. SCN 57-10 Glycine riboswitch
RS: URS0000C43AC7_1262825
MFE: -21.899
Ligand: TPP
Species: Clostridium sp. CAG:590 TPP riboswitch (THI element)
RS: URS000232E8B7_545619
MFE: -35.386
Ligand: SAM
Species: Paraoerskovia marina SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101576 URS0000C350B2_1660094 URS0000C43AC7_1262825 URS000232E8B7_545619
Length 106. 107. 106. 105.
Similarity - 0.977 0.975 0.975
Ensemble Norm 0.907 - - -
MFE -21.635 -26.616 -21.899 -35.386
Ligands - glycine TPP SAM
Gene SMR3A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 10.006 10.007
Length SE - 1. 0. 1.
Lev Distance - 27. 30. 29.
UBS 8. 9. 7. 10.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 2.
ILR 4. 4. 4. 4.
H 2. 2. 2. 2.
BL 3. 2. 1. 2.
BR 2. 3. 0. 3.
UN 0.160 0.103 0.236 0.076

Sequences

Field Description
UTR seq + 25 cuuucaacuggcaagagucauuuugaccagcagguuaaucaacucuaagacagauccucacgcaaagaggcaacugaaaggATGAAATCACTGACTTGGATCTTGG
UTR dot + 25 …….(((((((((….))))).))))………(((.((((((.((((((((((.((……))…)))..))))…….))).))))))..))).
RS 1 seq UGAAGCUUUGCGGGAGAGAGCAGCGUAGCUGCCGCCGAAGAUGAAAGUCUGUUGAACGUGUCAGGUUCGCAGAUGAACCUUUCAGGCAAAAGUACCGUGAAACUGAC
RS 1 dot …..((((((((.((..(……)..)).)))).))))……(((.(((..(((((((((((((……))))))….))))…….)))..))).)))
RS 2 seq UGAAUAGGAACGGGGAGCUUGUGAAGCAGGCUGAGAGGAAGUCAUCAACUUCGACCCGCAACCUGAUUUAGGUAAUGCUAACGUAGGGAUUCGAGAUAUGGGAUAA
RS 2 dot ……………(((((((…)))))))……..(((.(((..((((((((((((((((…)))))..)))…….)))..)))))…))))))..
RS 3 seq AACCCAUCCAGAGCGGUCGAGAGUCCUGGCUCGUCGACACCGCAGCAACCUGCCCGACGGAAGCCUCCCGAGGGGUACAGGUGCUAACGCCAGGUCCGAUGGAGA
RS 3 dot …….((((.((……..)).))))(((((((..((((((((.((((((((..(((…….)))..)))..))))))))…))..))).))))).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table