Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101606 Similarity: 0.951 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA101606
Gene: SMTNL2
MFE: -54.
ENS: 0.782
Length: 176.
Predicted Ligands:
lysine - 10/20
cobalamin - 8/20
Mg2+ - 2/20
 RS: URS000231F7A8_1618975
MFE: -66.376
Ligand: cobalamin
Species: Parcubacteria group bacterium GW2011_GWF2_50_9 Cobalamin riboswitch
 RS: URS0002332ED3_1797834
MFE: -66.434
Ligand: cobalamin
Species: Deltaproteobacteria bacterium RBG_13_61_14 Cobalamin riboswitch
 RS: URS0002331458_1121911
MFE: -30.617
Ligand: cobalamin
Species: Garciella nitratireducens DSM 15102 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101606 URS000231F7A8_1618975 URS0002332ED3_1797834 URS0002331458_1121911
Length 176. 176. 177. 176.
Similarity - 0.951 0.949 0.948
Ensemble Norm 0.782 - - -
MFE -54. -66.376 -66.434 -30.617
Ligands - cobalamin cobalamin cobalamin
Gene SMTNL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.005 31. 12.001
Length SE - 0. 1. 0.
Lev Distance - 61. 57. 66.
UBS 6. 8. 10. 7.
BS 2. 3. 2. 2.
ILL 2. 3. 3. 3.
ILR 1. 1. 2. 3.
H 4. 3. 4. 2.
BL 1. 2. 3. 2.
BR 0. 3. 3. 1.
UN 0.159 0.091 0.158 0.188

Sequences

Field Description
UTR seq + 25 agaguaggacugggaggggacagcgcguagucgcagagucagggaggggaccucaccaccugucuccucccugaggucuuagaacagauacaagaaauuccaggcgaaggucccacagaguuuggaucacgaugaggccagugagucggagATGGAGCCGGCCCCCGACGCCCAGG
UTR dot + 25 ………(((((.((((…..(((….)))….(((((((((((((……….)))))))))))))(((((((…..((……….(((((((…………..)))))))))….)))))))…..(((((……..)))))))))….))))).
RS 1 seq CGGGCGGCGGGGCGCUCCGGCAUCCACAAAAAUUUGCGGGCAUUGGGGAACGAGGUGAGAAUCCUCGACAGUGCCGCUACGGUGUUUCCUUCGGGAUUCAAGGUUCGACCUUUUUCCCGAUUCAAGGUCGAACCUUGGGGAAAGUCCGAGUACCAAGCCGCAAGUUAUCGGUUGCA
RS 1 dot ((((((……))).)))(((.((…..(((((((((((((((…..(((((…….))))).)))))).(((.(((..((((((……..((((((((((((((………..))))))))))))))))))))..))))))……)))))))))…)).))).
RS 2 seq UAAAACAUAACGCGUCCGGGUGCCCCUUGGGAUAAAAGGGAAGAGGGUGGAAAGCCCUCGCGGCCCCGCCACUGUGAUCGGUGACGAUCUCUCGAACAUGCCACUGUCCCGCCCGGGAUGGGAAGGCCGAGAGAUUAUGCCGUCAGCCAGGAAACCUGCCGGGACGCGCUUCACGUA
RS 2 dot ……….(((((((.((…(((((…….)))))…(((((((…(((…..))).))))).)).(((.((((…(((((((((…..(((.(((((((….)))))))…))))))))))))..)))))))..((((…)))))).)))))))………
RS 3 seq UUAAAUAUUAAAAUUUAAGGUGUUUUUAUUAAGGGAAAGAGGUGAAAAUCCUCUGCAGCCACCGCUACUGUGAGUAGGGAUGAAAUCUUUUUGUAAUCCACUGGUUUUUGCUGGGAAGGAAAAAGAAAGUAAGAUGAUCUACAAGCCAGGAGACCUGCCUUAAAUUUAGAACUAUU
RS 3 dot ……….(((((((((((……….(((.((((((((….((((.((((…(((…….))).))))))))…))))))))….((..((((((((((((……………)))))))……….)))))..))))))))))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table