Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101609 Similarity: 0.961 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA101609
Gene: SMU1
MFE: -41.608
ENS: 0.966
Length: 133.
Predicted Ligands:
FMN - 9/20
cobalamin - 6/20
TPP - 2/20
 RS: URS0000C4F608_220754
MFE: -39.264
Ligand: FMN
Species: Jeotgalibacillus campisalis FMN riboswitch (RFN element)
 RS: URS0000DA8ED3_1805397
MFE: -32.675
Ligand: TPP
Species: Thiomicrospira sp. CG2_30_44_34 TPP riboswitch (THI element)
 RS: URS0000AB3A17_279238
MFE: -54.724
Ligand: SAM
Species: Novosphingobium aromaticivorans DSM 12444 SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101609 URS0000C4F608_220754 URS0000DA8ED3_1805397 URS0000AB3A17_279238
Length 133. 133. 133. 134.
Similarity - 0.961 0.961 0.961
Ensemble Norm 0.966 - - -
MFE -41.608 -39.264 -32.675 -54.724
Ligands - FMN TPP SAM
Gene SMU1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 17.001 10. 6.004
Length SE - 0. 0. 1.
Lev Distance - 43. 47. 48.
UBS 12. 9. 10. 11.
BS 0. 1. 0. 0.
ILL 2. 3. 2. 2.
ILR 4. 3. 4. 4.
H 4. 4. 5. 3.
BL 3. 2. 2. 5.
BR 3. 1. 1. 3.
UN 0.038 0.075 0.053 0.104

Sequences

Field Description
UTR seq + 25 cgccgacccaagcggaagugacguuagguguccgccggaggugucguugguguguugcgcgacuggccuugagggagagcuggggccugcucccggagagauacggcuATGTCGATCGAAATCGAATCTTCGG
UTR dot + 25 ….(((((.((((…….)))).)).)))(.(..((((((((((..(…..)..)))))..)))))..).).((((……..))))((((((((((.((((…)))))))………)))))))
RS 1 seq UUCCAUCUUCAGGGCAGGGUGAAAUUCCCGACCGGCGGUAAAAGUAGAUUGAGCCCGCGAGCGAGUAGAGUUUACUUGCUGACUCCGUGAGAACCGGAGGCCGACAGUACAGUCUGGAUGGGAGAAGAUGGAG
RS 1 dot .(((((((((..((..(((…….)))..))..(((((..((((((((..((.((….)).))..))))))))))))).(((((…….))))).(((.(((……)))..)))..))))))))).
RS 2 seq CCCCAUCUCUCGGGGUGCACACCUAAGUGCUGAGACGACGAAGUAAAAUUGGAGCUGUUUCCUUUUUCCGGCAGUCGGGCCCGUUGAACUUGAUCUGGUUAAAACCAGCGUAGGGAAGAGAAGAUUCUUUGGG
RS 2 dot ((((…….)))).((((……)))).((((((.(.((……)).)…))))))…..((((…..))))((((..(((((((..(((((….)))))..))))……….)))..))))
RS 3 seq CCCCAACAUCGAGAGUUGGGGUGACGCUCCAACGCCAACCUGCCGUUCCGGGCAAGGUGGUACCCGAUCCGCAAGGCGGCCCCGGCCGAAUUGCGAAAGGGGAUGUGGCCGAUCCGGCAACCAAACGGACACGG
RS 3 dot (((((((…….)))))))…………(((.(((((((……)))).))))))..(((.((((…((..(((.((((((.(((.(…..).))).))))))….)))..))…))))..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table