Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101610 Similarity: 0.961 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA101610
Gene: SMU1_0
MFE: -42.756
ENS: 0.956
Length: 137.
Predicted Ligands:
FMN - 8/20
cobalamin - 4/20
molybdenum - 4/20
 RS: URS0000C1A3FA_1366046
MFE: -40.284
Ligand: FMN
Species: Rhodobacteraceae bacterium HIMB11 FMN riboswitch (RFN element)
 RS: URS0000BB9915_658057
MFE: -41.994
Ligand: FMN
Species: Roseovarius sp. HDW-9 FMN riboswitch (RFN element)
 RS: URS0000C60C76_988812
MFE: -45.
Ligand: FMN
Species: Marinovum algicola DG 898 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101610 URS0000C1A3FA_1366046 URS0000BB9915_658057 URS0000C60C76_988812
Length 137. 137. 137. 139.
Similarity - 0.961 0.960 0.960
Ensemble Norm 0.956 - - -
MFE -42.756 -40.284 -41.994 -45.
Ligands - FMN FMN FMN
Gene SMU1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.003 10.003 4.003
Length SE - 0. 0. 4.
Lev Distance - 44. 48. 47.
UBS 13. 12. 11. 14.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 2. 5. 3. 2.
H 4. 4. 4. 4.
BL 3. 4. 4. 4.
BR 5. 3. 3. 6.
UN 0. 0.051 0.058 0.050

Sequences

Field Description
UTR seq + 25 cagacgccgacccaagcggaagugacguuagguguccgccggaggugucguugguguguugcgcgacuggccuugagggagagcuggggccugcucccggagagauacggcuATGTCGATCGAAATCGAATCTTCGG
UTR dot + 25 ((((((((..((…(((((….((…..)).))))).)).))))))..))((((…))))(((.((((((.((……)))))))).).))((((((((((.((((…)))))))………)))))))
RS 1 seq GAAAAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAGGGAAAGCCCAAGCCCGCGAGCGCUCAGCGAUGAGGUCAGCAGAUCAGGUGCUAUUCCUGGGCCGACGGUUACAGUCCGGAUGAAAGAGAAUACGC
RS 1 dot …….(((.((((.((((….(((((.(((…)))..))))).))))..))))..)))(((…)))((..((((….))))..))(((((((((((((.(…….).))))))……..))))).))
RS 2 seq AUCAGUUCUCAGGGCGGGGUGUAAUUCCCCACCGGCGGUUAUAGCCCGCGAGCGCCUUGCAUUGUAAAAUGCUUGGGUCAGCAGAUUUGGUGGAAUUCCAAAGCCGACGGUUAAAGUCCGGAUGGUAGAGAAUGGAA
RS 2 dot ….((((…..(((((.(((((((.((….)).))))))).))))))))).((..(((((….)))))..)).(((.((….)).)))..(((((..((((.(((…….)))..))))……)))))
RS 3 seq UCGCGUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUCACAGCCCGCGAGCGCCUUUCGGGUCAGUCCCGCAAGGGUCAGCAGAUACCGGUGGAAUUCCGGAGCCGACGGUCAAAGUCCGGAUGGAAGAGAACCAGC
RS 3 dot ..((((((.(.((((…((((….((((…)).)))))).))))).))))))((.(((((((.(((((….)))…)).))).)))).))…(((((((((…)))…..))))))(((…….)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table