Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101726 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA101726
Gene: SMYD5
MFE: -23.027
ENS: 0.888
Length: 70.
Predicted Ligands:
homocysteine - 8/20
fluoride - 6/20
cobalamin - 4/20
 RS: URS0000D8B901_1945864
MFE: -20.307
Ligand: SAM
Species: Hydrogenophaga sp. A37 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D979C7_52694
MFE: -15.067
Ligand: fluoride
Species: Acetobacterium wieringae Fluoride riboswitch
 RS: URS0000AB5B72_338969
MFE: -24.746
Ligand: homocysteine
Species: Rhodoferax ferrireducens T118 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101726 URS0000D8B901_1945864 URS0000D979C7_52694 URS0000AB5B72_338969
Length 70. 71. 70. 71.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.888 - - -
MFE -23.027 -20.307 -15.067 -24.746
Ligands - SAM fluoride homocysteine
Gene SMYD5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 4.003 6.
Length SE - 1. 0. 1.
Lev Distance - 19. 21. 20.
UBS 6. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 3. 3. 1.
H 2. 2. 1. 1.
BL 2. 1. 1. 2.
BR 1. 0. 2. 3.
UN 0.086 0.042 0.143 0.099

Sequences

Field Description
UTR seq + 25 aggucgaggcgggguuaagggucauaaggcggaggcgcgcccaagATGGCGGCCTCCATGTGCGACGTGT
UTR dot + 25 …..(((((.(.(((..((((……(((….)))))))..)))..).)))))(((((…))))).
RS 1 seq CUGCCCUCCAGCGCCGAUUUGUCCGGAUUGCGGGCGCUUUACAAAUACCGCUAAAGGGGGGACUCCCGGUC
RS 1 dot …(((((.((((…(((((((((…..)))…….))))))..))))…)))))((((…))))
RS 2 seq UAUAAAACAGGUGAUGAAGUUCGCCCUGGCAACCGCCAAAAUGCGUUAAGCUGAUGACUUCUGUUAAAAU
RS 2 dot …..(((((((.((..(((((((..((((….))))….)))…)))).)).))..)))))…..
RS 3 seq UCUUCCAAGGAGCGUUGCAGUCGGCCACAUGGCCGGUCAGGCUUGGAUGACCCCAACGACGCUCACCUGAU
RS 3 dot …..((.(((((((((..((((.(((…((((…..))))))).))))…..)))))))).).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table