Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101731 Similarity: 0.975 Similarity: 0.975 Similarity: 0.971
UTR: 5HSAA101731
Gene: SNAP23
MFE: -37.655
ENS: 0.916
Length: 116.
Predicted Ligands:
FMN - 7/20
TPP - 5/20
methionine - 3/20
 RS: URS0000C69653_280871
MFE: -43.415
Ligand: TPP
Species: Mycobacterium llatzerense TPP riboswitch (THI element)
 RS: URS0000C8A128_12908
MFE: -31.
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000AB19D5_243275
MFE: -34.133
Ligand: TPP
Species: Treponema denticola ATCC 35405 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101731 URS0000C69653_280871 URS0000C8A128_12908 URS0000AB19D5_243275
Length 116. 116. 118. 117.
Similarity - 0.975 0.975 0.971
Ensemble Norm 0.916 - - -
MFE -37.655 -43.415 -31. -34.133
Ligands - TPP glutamine TPP
Gene SNAP23 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 2. 6.
Length SE - 0. 4. 1.
Lev Distance - 32. 28. 35.
UBS 9. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 1. 0. 1.
H 4. 4. 4. 4.
BL 4. 3. 3. 3.
BR 4. 3. 4. 2.
UN 0.155 0.147 0.136 0.162

Sequences

Field Description
UTR seq + 25 cgcgacuagggugcagcgccagguccgguguugggguguccgaguugccgccggagaggaguggccucgcccgcuugaguuuugauucaucATGGATAATCTGTCATCAGAAGAAA
UTR dot + 25 .((((((.((((.(((((((……))))))).)…))).)))))).((.((.((((…..)))).)).)).(((((….)))))……….((((….))))…..
RS 1 seq CAACGUCCGCGCGGGAGCGCACACCUUGGUGCGCUGAGAGGACGGCUGUAUGGCGCCGUCGACCGUAUGAACCUGACCGGGUAAUGCCGGCGUAGGGAGUAAGCAGAUGACUGCAA
RS 1 dot …(((((.(.(…(((((((……)))))))).).)))))…((((((((….)).))))))…((((.((((……))))..))))……((((….))))..
RS 2 seq AACGUUCAUCUUAUUUUAAGACGGAAGUAGGAAGAUACGAUCUGCGUUUACUCUUUCUGAGUGACGCAAGCUUUAGUCGAAAGACUAACAGUCCAUAGAUCUACCGAAGGAACGCGUU
RS 2 dot ..(((((.(((((((((……))))))))).)).)))…((((.((((((…..)))))))))).(((((((((….)))))).)))…..(.(((……))).)…..
RS 3 seq UCACAUCUGCCGGGGUGCUUUUACAAGCUGAGAACAUACCCGCAAAGGGCUGUCCGCACGGAUGCCCUAUUACCUGAUCCGGAUAAUACCGGCGGAGGGAGCAUAUGAAAAAUCAUU
RS 3 dot …….((.(((((((.(((((…..))))).))).)))))).(((((.((((….)))))))))….(((…((((……))))…)))……((((….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table