Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101765 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA101765
Gene: SNAP91
MFE: -35.057
ENS: 0.891
Length: 124.
Predicted Ligands:
guanidine - 5/20
glycine - 4/20
molybdenum - 4/20
 RS: URS0000C7DC4F_1455638
MFE: -26.847
Ligand: guanidine
Species: Bacillus sp. SA1-12 Guanidine-I riboswitch
 RS: URS0000C6970E_1423778
MFE: -33.448
Ligand: Mg2+
Species: Lactobacillus oligofermentans DSM 15707 = LMG 22743 FMN riboswitch (RFN element)
 RS: URS0000C58DA8_121719
MFE: -47.833
Ligand: glycine
Species: Pannonibacter phragmitetus Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101765 URS0000C7DC4F_1455638 URS0000C6970E_1423778 URS0000C58DA8_121719
Length 124. 125. 124. 124.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.891 - - -
MFE -35.057 -26.847 -33.448 -47.833
Ligands - guanidine Mg2+ glycine
Gene SNAP91 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 7.001 12.
Length SE - 1. 0. 0.
Lev Distance - 36. 37. 37.
UBS 9. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 4. 3. 3. 1.
H 2. 3. 2. 3.
BL 3. 3. 4. 3.
BR 1. 2. 3. 2.
UN 0.185 0.160 0.210 0.177

Sequences

Field Description
UTR seq + 25 auccgaugcauuccccgaagccugcgggcugcuaggaggaaagucugcugaggugggagaugggcaccgaagaggaggcgguagacgcgaccacagaagATGTCGGGCCAAACGCTCACGGATC
UTR dot + 25 ……..((((.(((…(((((((((((.((….))..)))))))..))))))).))))(((.((((…((..(((…..)))..))……….)))))))……………
RS 1 seq AAAAAAGCUGUCUAGGGUUCCGUUGAUAGAUGUAAAAUAAUCGGUCAAGACUGGUCCAAGAGAGAGCGUAUAGAAUUUACUUUUUGUAUCUUCUAUAUACACGGAAGGAUAAAAGCCUGGGAGAU
RS 1 dot ……(((.(((.(((..((((((((.(((……..))).)))))…))))))…))).)))((((((((..(((…..)))..))))))))…….(((…….)))…….
RS 2 seq GUUCGUCUUCAGGGCAGGGUGUAAUUCCCGACCGGCGGUGAUAGCCCGCGACCUGCAUUUUUUGCAGUUGAACUCGGUGGAAUUCCGGGUGCCGACAGUAGAGUCUGGUAUAAAGAAGAUUUUC
RS 2 dot ………((((((.((((…(((.(((…..))).))).))))))..))))((..((((((.((((.((((((…….))))))..)))).))))))..))……………..
RS 3 seq CUUUGACGCUCUGGAAAGCAGGCCUCGCAUGCUGAUGCGUGAGGCCUCACCGAAGGAGUAACCUUCCGGCUGCAUUCGUGCGCCGGGCGGGAAAUCUCUCAGGUACUCGGACAGAGGGGGUGCG
RS 3 dot …….(((((((…(.(((((((((..((….)))))))))))).))…)))))..((.((((((.(((….))))))))).))…………((((((………)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table